PTox-WP6-H295R

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnaseq analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-06, 19:58 UTC based on data in: /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-H295R/work/b0/a89e8cb4c28c629d56e7c73836e594

Because this report contains a lot of samples, you may need to click 'Show plot' to see some graphs.

General Statistics

Showing ²⁰⁴/₂₀₄ rows and ²²/₄₅ columns.

Sample Name	5'-3' bias	M Aligned	Exonic	Intronic	Intergenic	Overlapping Exon	Error rate	Non-primary	Reads mapped	% Mapped	% Proper pairs	% MapQ 0 reads	Total seqs	Mean insert	Reads	Reads mapped	% Reads mapped	rRNA	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	M Unique Reads	% Pass Dedup	Dups	GC	Avg len	Median len	Failed	Seqs	% > Q30	Mb Q30 bases	Reads After Filtering	GC content	% PF	% Adapter	Mean R1 Length	Dups	GC	Avg len	Median len	Failed	Seqs
UI014p1B1	1.06	1.0M	0.4M	0.3M	0.1M	0.1M	0.63%	0.7M	1.0M	100.0%	0.0%	6.2%	1.0M	0.0bp	1.7M	1.7M	100.0%	14.8%	9.8M	9.0M	92.5%	7.6M	77.5%	1.5M	1.7M	13.0%	66.4%	45.0%	151bp	151bp	27%	16.7M	86.1%	1032.8Mb	11.4M	40.0%	68.5%	53.4%	141.0bp	83.4%	39.0%	105bp	132bp	18%	11.4M
UI014p1B2	0.83	0.8M	0.3M	0.2M	0.1M	0.0M	0.70%	0.7M	0.8M	100.0%	0.0%	7.8%	0.8M	0.0bp	1.5M	1.5M	100.0%	16.4%	13.6M	12.5M	91.6%	9.9M	72.5%	2.6M	1.5M	8.2%	72.5%	45.0%	151bp	151bp	27%	22.1M	85.2%	1509.7Mb	16.3M	39.8%	73.9%	45.9%	141.0bp	87.1%	39.0%	109bp	137bp	18%	16.3M
UI014p1B3	0.95	1.0M	0.4M	0.3M	0.1M	0.1M	0.61%	0.7M	1.0M	100.0%	0.0%	5.6%	1.0M	0.0bp	1.6M	1.6M	100.0%	15.8%	9.4M	8.9M	95.0%	7.4M	79.0%	1.5M	1.6M	12.8%	70.1%	42.0%	151bp	151bp	27%	14.1M	86.4%	1043.7Mb	11.1M	39.9%	78.9%	45.6%	141.0bp	84.7%	39.0%	109bp	137bp	27%	11.1M
UI014p1B4	0.77	0.9M	0.4M	0.2M	0.1M	0.1M	0.64%	0.7M	0.9M	100.0%	0.0%	6.1%	0.9M	0.0bp	1.6M	1.6M	100.0%	16.7%	15.6M	14.8M	95.0%	12.4M	79.5%	2.4M	1.6M	7.5%	77.3%	43.0%	151bp	151bp	27%	23.4M	86.5%	1776.4Mb	18.8M	40.3%	80.2%	44.3%	141.0bp	89.4%	40.0%	110bp	137bp	27%	18.8M
UI014p1B5	0.86	0.8M	0.3M	0.2M	0.1M	0.0M	0.67%	0.6M	0.8M	100.0%	0.0%	7.1%	0.8M	0.0bp	1.4M	1.4M	100.0%	14.0%	14.2M	13.0M	91.6%	10.7M	75.5%	2.3M	1.4M	7.4%	72.7%	45.0%	151bp	151bp	27%	24.4M	86.0%	1521.4Mb	16.5M	40.2%	67.8%	51.0%	141.0bp	87.4%	40.0%	107bp	137bp	18%	16.5M
UI014p1B6	0.75	1.1M	0.4M	0.3M	0.1M	0.1M	0.60%	0.7M	1.1M	100.0%	0.0%	5.4%	1.1M	0.0bp	1.9M	1.9M	100.0%	14.4%	13.2M	12.3M	93.1%	10.3M	78.3%	2.0M	1.9M	10.9%	70.7%	43.0%	151bp	151bp	27%	20.8M	86.2%	1468.8Mb	15.4M	39.2%	74.3%	45.8%	141.0bp	84.7%	39.0%	110bp	137bp	18%	15.4M
UI014p2B1	1.28	0.7M	0.2M	0.2M	0.1M	0.0M	0.69%	0.6M	0.7M	100.0%	0.0%	7.4%	0.7M	0.0bp	1.4M	1.4M	100.0%	14.6%	11.5M	10.6M	92.4%	9.0M	77.9%	1.7M	1.4M	8.9%	72.2%	45.0%	151bp	151bp	27%	18.7M	85.8%	1228.5Mb	13.5M	40.2%	72.2%	50.3%	141.0bp	87.2%	40.0%	106bp	132bp	18%	13.5M
UI014p2B2	0.84	1.2M	0.5M	0.4M	0.1M	0.1M	0.59%	0.8M	1.2M	100.0%	0.0%	5.3%	1.2M	0.0bp	2.0M	2.0M	100.0%	15.4%	11.6M	10.9M	94.2%	9.3M	79.9%	1.7M	2.0M	13.0%	69.9%	43.0%	151bp	151bp	27%	17.8M	85.7%	1274.4Mb	13.7M	39.4%	76.9%	46.4%	141.0bp	83.7%	39.0%	108bp	137bp	18%	13.7M
UI014p2B3	0.77	1.5M	0.6M	0.5M	0.1M	0.1M	0.60%	0.9M	1.5M	100.0%	0.0%	5.0%	1.5M	0.0bp	2.3M	2.3M	100.0%	15.6%	14.2M	13.5M	95.0%	11.5M	81.1%	2.0M	2.3M	12.5%	71.3%	42.0%	151bp	151bp	27%	20.4M	85.5%	1584.2Mb	16.8M	39.5%	82.5%	41.9%	141.0bp	84.0%	39.0%	110bp	137bp	18%	16.8M
UI014p2B4	0.69	1.4M	0.5M	0.4M	0.1M	0.1M	0.59%	0.8M	1.4M	100.0%	0.0%	4.9%	1.4M	0.0bp	2.2M	2.2M	100.0%	15.4%	14.7M	14.0M	95.3%	11.8M	80.1%	2.2M	2.2M	11.2%	72.5%	41.0%	151bp	151bp	27%	21.7M	86.0%	1646.9Mb	17.4M	39.1%	80.3%	43.8%	141.0bp	85.5%	39.0%	110bp	137bp	18%	17.4M
UI014p2B5	0.69	1.2M	0.5M	0.4M	0.1M	0.1M	0.61%	0.7M	1.2M	100.0%	0.0%	4.9%	1.2M	0.0bp	1.9M	1.9M	100.0%	13.8%	16.7M	16.0M	95.8%	13.8M	82.6%	2.2M	1.9M	8.8%	76.3%	41.0%	151bp	151bp	27%	23.0M	86.7%	1875.1Mb	19.3M	39.8%	84.1%	41.1%	141.0bp	87.9%	39.0%	112bp	141bp	18%	19.3M
UI014p2B6	0.83	1.5M	0.6M	0.5M	0.1M	0.1M	0.57%	0.9M	1.5M	100.0%	0.0%	4.9%	1.5M	0.0bp	2.4M	2.4M	100.0%	12.7%	14.8M	13.8M	93.2%	11.8M	80.0%	1.9M	2.4M	12.6%	69.1%	42.0%	151bp	151bp	27%	22.0M	86.0%	1660.4Mb	16.9M	39.0%	76.8%	41.5%	141.0bp	83.4%	39.0%	114bp	141bp	18%	16.9M
UI015p1C1	1.09	1.0M	0.4M	0.3M	0.1M	0.1M	0.63%	0.7M	1.0M	100.0%	0.0%	6.2%	1.0M	0.0bp	1.7M	1.7M	100.0%	14.4%	11.9M	11.2M	93.8%	9.5M	79.4%	1.7M	1.7M	10.8%	71.5%	43.0%	151bp	151bp	27%	18.7M	86.3%	1310.9Mb	13.9M	39.4%	74.6%	46.7%	141.0bp	86.1%	39.0%	109bp	137bp	18%	13.9M
UI015p1C2	0.79	1.0M	0.4M	0.3M	0.1M	0.1M	0.63%	0.8M	1.0M	100.0%	0.0%	7.1%	1.0M	0.0bp	1.8M	1.8M	100.0%	15.7%	13.3M	12.0M	90.6%	9.8M	74.2%	2.2M	1.8M	10.3%	69.8%	45.0%	151bp	151bp	27%	22.9M	85.5%	1431.5Mb	15.7M	39.4%	68.8%	50.3%	141.0bp	85.3%	39.0%	106bp	132bp	18%	15.7M
UI015p1C3	0.86	1.1M	0.4M	0.3M	0.1M	0.1M	0.62%	0.7M	1.1M	100.0%	0.0%	5.4%	1.1M	0.0bp	1.9M	1.9M	100.0%	16.0%	12.5M	11.9M	95.2%	9.9M	79.3%	2.0M	1.9M	11.2%	72.7%	42.0%	151bp	151bp	27%	18.5M	86.1%	1398.9Mb	14.9M	39.8%	80.7%	44.3%	141.0bp	85.7%	39.0%	109bp	137bp	27%	14.9M
UI015p1C4	0.85	1.1M	0.5M	0.3M	0.1M	0.1M	0.60%	0.7M	1.1M	100.0%	0.0%	5.2%	1.1M	0.0bp	1.9M	1.9M	100.0%	16.0%	12.4M	11.8M	95.0%	9.8M	79.3%	2.0M	1.9M	11.3%	72.5%	41.0%	151bp	151bp	27%	18.7M	86.1%	1404.0Mb	14.8M	39.0%	78.9%	43.1%	141.0bp	85.7%	39.0%	110bp	137bp	18%	14.8M
UI015p1C5	0.95	0.5M	0.2M	0.1M	0.1M	0.0M	0.67%	0.5M	0.5M	100.0%	0.0%	7.3%	0.5M	0.0bp	1.0M	1.0M	100.0%	14.6%	9.0M	8.2M	91.3%	6.8M	76.2%	1.4M	1.0M	8.4%	71.1%	49.0%	151bp	151bp	36%	16.8M	86.0%	964.0Mb	10.5M	41.0%	62.8%	54.6%	141.0bp	86.7%	40.0%	107bp	132bp	18%	10.5M
UI015p1C6	0.88	1.1M	0.4M	0.3M	0.1M	0.1M	0.61%	0.7M	1.1M	100.0%	0.0%	5.5%	1.1M	0.0bp	1.8M	1.8M	100.0%	15.1%	14.3M	13.4M	93.3%	11.3M	79.2%	2.0M	1.8M	9.7%	71.4%	44.0%	151bp	151bp	27%	22.8M	85.4%	1605.5Mb	16.9M	39.3%	74.0%	44.0%	141.0bp	86.0%	39.0%	112bp	137bp	18%	16.9M
UI015p2C1	1.33	0.7M	0.2M	0.2M	0.1M	0.0M	0.68%	0.7M	0.7M	100.0%	0.0%	8.6%	0.7M	0.0bp	1.4M	1.4M	100.0%	12.5%	13.7M	12.4M	90.1%	10.3M	75.3%	2.0M	1.4M	7.4%	72.0%	47.0%	151bp	151bp	27%	25.2M	85.6%	1413.7Mb	15.7M	39.7%	62.2%	54.3%	141.0bp	87.7%	39.0%	105bp	132bp	18%	15.7M
UI015p2C2	1.14	1.0M	0.4M	0.3M	0.1M	0.1M	0.60%	0.8M	1.0M	100.0%	0.0%	6.4%	1.0M	0.0bp	1.8M	1.8M	100.0%	13.8%	12.9M	11.9M	91.9%	9.9M	76.3%	2.0M	1.8M	10.6%	71.4%	45.0%	151bp	151bp	27%	20.9M	85.9%	1361.5Mb	15.0M	39.6%	71.9%	50.3%	141.0bp	84.5%	39.0%	106bp	132bp	18%	15.0M
UI015p2C3	0.76	1.1M	0.4M	0.3M	0.1M	0.1M	0.60%	0.7M	1.1M	100.0%	0.0%	5.8%	1.1M	0.0bp	1.8M	1.8M	100.0%	16.1%	14.4M	13.6M	94.3%	11.5M	80.1%	2.1M	1.8M	9.4%	73.9%	43.0%	151bp	151bp	27%	22.7M	86.0%	1578.7Mb	17.2M	39.3%	75.5%	48.7%	141.0bp	86.8%	39.0%	107bp	137bp	18%	17.2M
UI015p2C4	0.99	1.2M	0.4M	0.4M	0.1M	0.1M	0.58%	0.7M	1.2M	100.0%	0.0%	5.1%	1.2M	0.0bp	1.9M	1.9M	100.0%	13.0%	11.7M	11.1M	95.0%	9.6M	81.5%	1.6M	1.9M	12.2%	71.2%	44.0%	151bp	151bp	27%	17.0M	86.8%	1258.5Mb	13.5M	40.4%	79.3%	47.4%	141.0bp	84.5%	40.0%	108bp	137bp	18%	13.5M
UI015p2C5	1.07	0.8M	0.3M	0.3M	0.1M	0.1M	0.59%	0.5M	0.8M	100.0%	0.0%	5.4%	0.8M	0.0bp	1.3M	1.3M	100.0%	12.7%	13.1M	12.4M	95.1%	10.8M	82.5%	1.6M	1.3M	8.0%	76.3%	43.0%	151bp	151bp	27%	18.7M	86.9%	1464.6Mb	15.0M	40.0%	80.1%	42.4%	141.0bp	88.3%	39.0%	112bp	141bp	18%	15.0M
UI015p2C6	3.10	0.8M	0.2M	0.3M	0.1M	0.0M	0.63%	0.9M	0.8M	100.0%	0.0%	9.5%	0.8M	0.0bp	1.7M	1.7M	100.0%	13.9%	5.4M	3.8M	71.3%	2.7M	50.6%	1.1M	1.7M	21.3%	59.4%	57.0%	151bp	151bp	36%	21.4M	80.1%	373.4Mb	6.2M	42.7%	29.1%	79.5%	141.0bp	69.8%	42.0%	75bp	67bp	27%	6.2M
UI016p1D1	1.31	0.9M	0.3M	0.3M	0.1M	0.0M	0.64%	0.9M	0.9M	100.0%	0.0%	8.2%	0.9M	0.0bp	1.8M	1.8M	100.0%	14.2%	8.5M	6.9M	80.8%	5.5M	64.0%	1.4M	1.8M	15.6%	61.5%	52.0%	151bp	151bp	27%	22.2M	83.7%	776.2Mb	9.9M	40.4%	44.7%	67.9%	141.0bp	77.4%	40.0%	94bp	92bp	18%	9.9M
UI016p1D2	0.81	0.9M	0.3M	0.3M	0.1M	0.1M	0.63%	0.8M	0.9M	100.0%	0.0%	7.2%	0.9M	0.0bp	1.6M	1.6M	100.0%	15.4%	9.0M	8.1M	90.3%	6.7M	75.2%	1.4M	1.6M	13.7%	65.2%	46.0%	151bp	151bp	27%	16.2M	85.6%	942.3Mb	10.6M	40.1%	65.5%	54.8%	141.0bp	82.3%	40.0%	104bp	127bp	18%	10.6M
UI016p1D3	1.02	0.7M	0.2M	0.2M	0.1M	0.0M	0.68%	0.7M	0.7M	100.0%	0.0%	8.2%	0.7M	0.0bp	1.4M	1.4M	100.0%	14.8%	10.5M	9.4M	89.4%	7.8M	74.0%	1.6M	1.4M	9.8%	68.8%	47.0%	151bp	151bp	27%	19.9M	85.4%	1100.1Mb	12.3M	39.7%	61.9%	54.8%	141.0bp	85.7%	39.0%	104bp	132bp	18%	12.3M
UI016p1D4	0.80	1.0M	0.4M	0.3M	0.1M	0.1M	0.62%	0.8M	1.0M	100.0%	0.0%	6.8%	1.0M	0.0bp	1.8M	1.8M	100.0%	15.0%	10.9M	9.9M	91.1%	8.3M	76.4%	1.6M	1.8M	12.4%	66.9%	46.0%	151bp	151bp	27%	19.4M	85.7%	1166.8Mb	12.8M	40.0%	66.2%	52.1%	141.0bp	83.5%	39.0%	106bp	132bp	18%	12.8M
UI016p1D5	0.86	1.0M	0.4M	0.3M	0.1M	0.1M	0.62%	0.7M	1.0M	100.0%	0.0%	6.1%	1.0M	0.0bp	1.7M	1.7M	100.0%	15.3%	12.1M	11.3M	93.4%	9.5M	79.0%	1.7M	1.7M	10.5%	70.8%	45.0%	151bp	151bp	27%	19.6M	86.2%	1312.3Mb	14.2M	40.6%	72.6%	50.0%	141.0bp	86.0%	40.0%	107bp	132bp	27%	14.2M
UI016p1D6	0.77	1.0M	0.4M	0.3M	0.1M	0.1M	0.60%	0.7M	1.0M	100.0%	0.0%	5.3%	1.0M	0.0bp	1.7M	1.7M	100.0%	13.9%	10.2M	9.4M	92.2%	8.0M	78.3%	1.4M	1.7M	12.9%	67.2%	44.0%	151bp	151bp	27%	17.0M	86.0%	1131.3Mb	11.9M	39.5%	69.8%	47.2%	141.0bp	82.8%	39.0%	111bp	137bp	18%	11.9M
UI016p2A1	0.93	0.9M	0.3M	0.3M	0.1M	0.0M	0.64%	0.7M	0.9M	100.0%	0.0%	7.3%	0.9M	0.0bp	1.6M	1.6M	100.0%	15.1%	8.9M	8.1M	90.2%	6.4M	71.6%	1.7M	1.6M	13.1%	64.5%	47.0%	151bp	151bp	27%	16.5M	85.5%	929.1Mb	10.5M	40.0%	63.9%	55.5%	141.0bp	82.2%	40.0%	103bp	127bp	18%	10.5M
UI016p2A2	1.02	0.9M	0.3M	0.2M	0.1M	0.0M	0.63%	0.7M	0.9M	100.0%	0.0%	7.1%	0.9M	0.0bp	1.6M	1.6M	100.0%	16.2%	9.2M	8.4M	90.6%	7.0M	75.7%	1.4M	1.6M	12.8%	67.0%	46.0%	151bp	151bp	27%	16.6M	85.3%	988.2Mb	11.0M	39.4%	66.6%	53.3%	141.0bp	83.0%	39.0%	105bp	132bp	18%	11.0M
UI016p2A3	0.77	1.1M	0.4M	0.3M	0.1M	0.1M	0.61%	0.7M	1.1M	100.0%	0.0%	5.7%	1.1M	0.0bp	1.8M	1.8M	100.0%	15.6%	11.5M	10.8M	94.0%	9.2M	79.8%	1.6M	1.8M	12.0%	70.8%	44.0%	151bp	151bp	27%	17.7M	86.1%	1254.2Mb	13.6M	40.0%	76.9%	47.6%	141.0bp	84.8%	40.0%	107bp	137bp	27%	13.6M
UI016p2A4	0.61	1.4M	0.5M	0.4M	0.1M	0.1M	0.61%	0.9M	1.4M	100.0%	0.0%	5.2%	1.4M	0.0bp	2.3M	2.3M	100.0%	14.9%	12.2M	11.3M	93.2%	9.5M	78.0%	1.8M	2.3M	14.2%	66.3%	45.0%	151bp	151bp	27%	18.7M	85.2%	1338.5Mb	14.3M	40.0%	76.1%	44.9%	141.0bp	81.6%	40.0%	110bp	137bp	18%	14.3M
UI016p2A5	0.82	1.3M	0.5M	0.4M	0.1M	0.1M	0.61%	0.8M	1.3M	100.0%	0.0%	5.4%	1.3M	0.0bp	2.1M	2.1M	100.0%	12.6%	11.5M	10.8M	93.6%	9.1M	79.5%	1.6M	2.1M	13.7%	67.7%	45.0%	151bp	151bp	27%	17.6M	86.0%	1248.7Mb	13.2M	39.9%	74.7%	45.8%	141.0bp	82.5%	39.0%	110bp	137bp	18%	13.2M
UI016p2A6	1.51	1.0M	0.3M	0.3M	0.1M	0.0M	0.62%	0.9M	1.0M	100.0%	0.0%	7.5%	1.0M	0.0bp	1.9M	1.9M	100.0%	14.6%	7.0M	5.6M	81.1%	4.5M	64.2%	1.2M	1.9M	19.9%	58.9%	53.0%	151bp	151bp	27%	20.5M	83.3%	609.7Mb	8.2M	40.1%	39.7%	72.0%	141.0bp	74.1%	40.0%	90bp	87bp	18%	8.2M
UI017p3B1	0.83	0.5M	0.2M	0.1M	0.1M	0.0M	0.69%	0.3M	0.5M	100.0%	0.0%	4.8%	0.5M	0.0bp	0.7M	0.7M	100.0%	15.4%	10.0M	9.7M	96.7%	8.4M	83.6%	1.3M	0.7M	5.8%	82.2%	39.0%	151bp	151bp	27%	13.2M	86.6%	1213.1Mb	11.9M	39.2%	89.5%	27.8%	141.0bp	91.2%	39.0%	118bp	141bp	18%	11.9M
UI017p3B2	0.86	1.0M	0.4M	0.3M	0.1M	0.1M	0.60%	0.6M	1.0M	100.0%	0.0%	4.6%	1.0M	0.0bp	1.6M	1.6M	100.0%	16.8%	11.9M	11.5M	96.3%	9.8M	82.5%	1.7M	1.6M	10.8%	77.3%	38.0%	151bp	151bp	27%	15.9M	86.2%	1411.7Mb	14.3M	38.5%	89.9%	32.6%	141.0bp	87.1%	38.0%	114bp	141bp	27%	14.3M
UI017p3B3	0.67	0.7M	0.3M	0.2M	0.1M	0.0M	0.68%	0.5M	0.7M	100.0%	0.0%	5.8%	0.7M	0.0bp	1.2M	1.2M	100.0%	14.7%	13.3M	12.7M	95.6%	11.0M	82.3%	1.8M	1.2M	7.3%	79.8%	40.0%	151bp	151bp	27%	17.8M	86.5%	1571.2Mb	15.6M	39.3%	87.5%	31.3%	141.0bp	89.6%	39.0%	116bp	141bp	18%	15.6M
UI017p3B4	0.85	0.7M	0.3M	0.2M	0.1M	0.0M	0.68%	0.5M	0.7M	100.0%	0.0%	5.7%	0.7M	0.0bp	1.2M	1.2M	100.0%	14.6%	14.5M	13.8M	95.2%	11.9M	81.9%	1.9M	1.2M	6.4%	79.6%	39.0%	151bp	151bp	27%	20.0M	86.2%	1707.1Mb	17.0M	38.4%	85.2%	32.0%	141.0bp	89.9%	38.0%	116bp	141bp	18%	17.0M
UI017p3B5	0.97	0.6M	0.2M	0.1M	0.1M	0.0M	0.75%	0.5M	0.6M	100.0%	0.0%	7.6%	0.6M	0.0bp	1.1M	1.1M	100.0%	11.2%	17.5M	16.4M	93.4%	13.9M	79.2%	2.5M	1.1M	4.8%	78.3%	43.0%	151bp	151bp	27%	25.7M	86.3%	1923.5Mb	19.8M	40.0%	76.9%	42.3%	141.0bp	90.5%	39.0%	113bp	141bp	18%	19.8M
UI017p3B6	0.64	1.1M	0.4M	0.3M	0.1M	0.1M	0.64%	0.7M	1.1M	100.0%	0.0%	5.4%	1.1M	0.0bp	1.7M	1.7M	100.0%	15.2%	14.9M	14.2M	94.9%	12.0M	80.5%	2.1M	1.7M	9.2%	75.2%	40.0%	151bp	151bp	27%	21.3M	85.8%	1738.2Mb	17.6M	38.9%	82.7%	35.4%	141.0bp	87.3%	38.0%	115bp	141bp	18%	17.6M
UI017p4B1	0.90	0.7M	0.3M	0.2M	0.1M	0.0M	0.66%	0.4M	0.7M	100.0%	0.0%	4.6%	0.7M	0.0bp	1.1M	1.1M	100.0%	15.4%	9.3M	9.0M	96.4%	7.7M	83.3%	1.2M	1.1M	8.9%	77.0%	39.0%	151bp	151bp	27%	12.3M	85.9%	1108.1Mb	11.0M	38.9%	89.2%	29.5%	141.0bp	87.9%	38.0%	117bp	141bp	18%	11.0M
UI017p4B2	0.76	0.9M	0.4M	0.2M	0.1M	0.1M	0.64%	0.6M	0.9M	100.0%	0.0%	5.2%	0.9M	0.0bp	1.5M	1.5M	100.0%	18.1%	12.9M	12.3M	95.8%	10.4M	80.7%	1.9M	1.5M	9.0%	77.9%	39.0%	151bp	151bp	27%	17.8M	85.7%	1529.9Mb	15.7M	38.8%	88.2%	34.3%	141.0bp	88.2%	38.0%	114bp	141bp	27%	15.7M
UI017p4B3	0.70	1.1M	0.4M	0.3M	0.1M	0.1M	0.62%	0.7M	1.1M	100.0%	0.0%	5.1%	1.1M	0.0bp	1.8M	1.8M	100.0%	12.1%	17.2M	16.5M	95.7%	14.1M	81.9%	2.4M	1.8M	8.1%	77.2%	41.0%	151bp	151bp	27%	22.8M	86.6%	1928.7Mb	19.6M	39.7%	86.1%	37.6%	141.0bp	88.0%	39.0%	114bp	141bp	18%	19.6M
UI017p4B4	0.90	0.4M	0.2M	0.1M	0.1M	0.0M	0.75%	0.4M	0.4M	100.0%	0.0%	6.9%	0.4M	0.0bp	0.8M	0.8M	100.0%	13.7%	12.1M	11.5M	95.1%	9.8M	81.3%	1.7M	0.8M	5.3%	81.3%	40.0%	151bp	151bp	27%	16.2M	86.1%	1415.8Mb	14.0M	39.4%	86.7%	30.3%	141.0bp	91.0%	39.0%	117bp	141bp	18%	14.0M
UI017p4B5	0.96	0.5M	0.2M	0.1M	0.0M	0.0M	0.69%	0.3M	0.5M	100.0%	0.0%	5.4%	0.5M	0.0bp	0.8M	0.8M	100.0%	15.5%	13.0M	12.4M	95.7%	10.7M	82.7%	1.7M	0.8M	4.7%	81.7%	40.0%	151bp	151bp	27%	18.1M	86.4%	1562.2Mb	15.4M	39.0%	84.9%	31.2%	141.0bp	91.7%	39.0%	118bp	141bp	18%	15.4M
UI017p4B6	0.71	1.1M	0.5M	0.3M	0.1M	0.1M	0.62%	0.6M	1.1M	100.0%	0.0%	4.4%	1.1M	0.0bp	1.7M	1.7M	100.0%	14.3%	13.9M	13.3M	95.8%	11.6M	83.0%	1.8M	1.7M	9.8%	76.2%	40.0%	151bp	151bp	27%	18.8M	86.2%	1665.1Mb	16.2M	39.0%	86.3%	28.8%	141.0bp	87.1%	38.0%	119bp	141bp	18%	16.2M
UI018p3C1	0.92	0.4M	0.2M	0.1M	0.0M	0.0M	0.75%	0.3M	0.4M	100.0%	0.0%	6.6%	0.4M	0.0bp	0.7M	0.7M	100.0%	12.8%	11.6M	11.0M	94.4%	9.4M	80.6%	1.6M	0.7M	4.4%	81.8%	41.0%	151bp	151bp	27%	15.9M	86.1%	1345.1Mb	13.3M	39.4%	83.8%	32.1%	141.0bp	91.3%	39.0%	117bp	141bp	18%	13.3M
UI018p3C2	0.87	0.9M	0.4M	0.2M	0.1M	0.1M	0.61%	0.5M	0.9M	100.0%	0.0%	4.3%	0.9M	0.0bp	1.4M	1.4M	100.0%	15.7%	8.7M	8.4M	96.4%	7.2M	82.8%	1.2M	1.4M	12.3%	73.4%	39.0%	151bp	151bp	27%	11.8M	86.0%	1021.5Mb	10.3M	38.9%	87.4%	31.7%	141.0bp	85.1%	38.0%	115bp	141bp	18%	10.3M
UI018p3C3	0.87	0.8M	0.3M	0.2M	0.1M	0.0M	0.67%	0.6M	0.8M	100.0%	0.0%	6.2%	0.8M	0.0bp	1.3M	1.3M	100.0%	12.3%	11.8M	11.1M	94.1%	9.4M	79.1%	1.8M	1.3M	8.4%	73.7%	43.0%	151bp	151bp	27%	17.2M	86.3%	1281.5Mb	13.5M	40.4%	78.5%	44.4%	141.0bp	87.4%	40.0%	110bp	137bp	18%	13.5M
UI018p3C4	0.69	1.0M	0.4M	0.2M	0.1M	0.1M	0.63%	0.6M	1.0M	100.0%	0.0%	4.9%	1.0M	0.0bp	1.6M	1.6M	100.0%	15.5%	13.1M	12.6M	96.1%	10.7M	82.1%	1.8M	1.6M	9.5%	77.7%	40.0%	151bp	151bp	27%	17.2M	85.8%	1553.6Mb	15.5M	39.2%	89.8%	29.6%	141.0bp	87.8%	39.0%	117bp	141bp	18%	15.5M
UI018p3C5	0.86	0.6M	0.3M	0.2M	0.1M	0.0M	0.68%	0.5M	0.6M	100.0%	0.0%	6.7%	0.6M	0.0bp	1.2M	1.2M	100.0%	16.8%	13.3M	12.5M	93.8%	10.6M	79.8%	1.9M	1.2M	6.8%	76.9%	43.0%	151bp	151bp	27%	20.3M	86.0%	1519.4Mb	16.0M	39.9%	78.5%	42.6%	141.0bp	89.6%	39.0%	111bp	137bp	27%	16.0M
UI018p3C6	0.72	1.0M	0.4M	0.2M	0.1M	0.1M	0.62%	0.6M	1.0M	100.0%	0.0%	5.1%	1.0M	0.0bp	1.5M	1.5M	100.0%	16.3%	10.9M	10.3M	94.6%	8.7M	80.2%	1.6M	1.5M	11.2%	74.1%	40.0%	151bp	151bp	27%	15.1M	85.7%	1290.5Mb	13.0M	38.9%	85.6%	32.2%	141.0bp	86.2%	38.0%	116bp	141bp	18%	13.0M
UI018p4C1	0.96	0.8M	0.3M	0.2M	0.1M	0.1M	0.66%	0.5M	0.8M	100.0%	0.0%	5.4%	0.8M	0.0bp	1.3M	1.3M	100.0%	13.4%	10.7M	10.1M	95.1%	8.6M	80.5%	1.5M	1.3M	9.2%	75.7%	41.0%	151bp	151bp	27%	14.5M	86.0%	1225.2Mb	12.3M	39.2%	85.0%	32.9%	141.0bp	86.8%	39.0%	116bp	141bp	18%	12.3M
UI018p4C2	0.76	0.7M	0.3M	0.2M	0.1M	0.1M	0.61%	0.4M	0.7M	100.0%	0.0%	4.5%	0.7M	0.0bp	1.1M	1.1M	100.0%	15.5%	10.4M	10.1M	96.6%	8.7M	83.5%	1.4M	1.1M	8.6%	78.7%	39.0%	151bp	151bp	27%	13.7M	86.7%	1246.8Mb	12.4M	39.6%	89.9%	31.6%	141.0bp	88.6%	39.0%	116bp	141bp	18%	12.4M
UI018p4C3	0.88	1.2M	0.5M	0.3M	0.1M	0.1M	0.62%	0.7M	1.2M	100.0%	0.0%	5.1%	1.2M	0.0bp	1.9M	1.9M	100.0%	12.1%	14.7M	14.1M	95.6%	12.0M	81.4%	2.1M	1.9M	9.9%	75.2%	41.0%	151bp	151bp	27%	19.6M	86.3%	1641.3Mb	16.8M	39.7%	85.6%	38.2%	141.0bp	86.3%	39.0%	114bp	141bp	18%	16.8M
UI018p4C4	0.70	0.6M	0.3M	0.1M	0.1M	0.0M	0.69%	0.5M	0.6M	100.0%	0.0%	6.4%	0.6M	0.0bp	1.1M	1.1M	100.0%	14.3%	11.6M	11.0M	94.4%	9.4M	80.6%	1.6M	1.1M	7.4%	76.8%	41.0%	151bp	151bp	27%	16.2M	85.8%	1347.7Mb	13.5M	39.1%	83.4%	33.9%	141.0bp	88.9%	39.0%	116bp	141bp	18%	13.5M
UI018p4C5	0.78	0.7M	0.3M	0.1M	0.1M	0.1M	0.68%	0.5M	0.7M	100.0%	0.0%	6.0%	0.7M	0.0bp	1.2M	1.2M	100.0%	16.3%	15.1M	14.4M	95.4%	12.3M	81.5%	2.1M	1.2M	6.2%	79.3%	41.0%	151bp	151bp	27%	21.5M	85.8%	1787.7Mb	18.0M	39.1%	83.6%	32.5%	141.0bp	90.5%	39.0%	116bp	141bp	18%	18.0M
UI018p4C6	0.90	1.0M	0.3M	0.3M	0.1M	0.1M	0.64%	0.9M	1.0M	100.0%	0.0%	7.7%	1.0M	0.0bp	1.8M	1.8M	100.0%	16.4%	8.2M	7.0M	85.1%	5.4M	65.5%	1.6M	1.8M	16.0%	61.8%	50.0%	151bp	151bp	27%	18.5M	84.2%	782.6Mb	9.8M	40.6%	53.3%	64.8%	141.0bp	78.6%	40.0%	95bp	92bp	27%	9.8M
UI019p3D1	0.93	1.0M	0.3M	0.3M	0.1M	0.1M	0.65%	0.8M	1.0M	100.0%	0.0%	7.1%	1.0M	0.0bp	1.8M	1.8M	100.0%	16.0%	9.4M	8.5M	90.1%	7.1M	75.0%	1.4M	1.8M	14.0%	66.4%	45.0%	151bp	151bp	27%	15.8M	84.9%	1001.7Mb	11.2M	39.9%	71.0%	50.5%	141.0bp	81.8%	39.0%	105bp	132bp	27%	11.2M
UI019p3D2	1.00	0.6M	0.2M	0.2M	0.1M	0.0M	0.70%	0.5M	0.6M	100.0%	0.0%	6.5%	0.6M	0.0bp	1.1M	1.1M	100.0%	15.8%	8.9M	8.4M	94.3%	7.1M	79.8%	1.3M	1.1M	9.5%	75.0%	41.0%	151bp	151bp	27%	12.5M	85.2%	1022.3Mb	10.6M	39.6%	84.2%	35.0%	141.0bp	87.2%	39.0%	114bp	141bp	18%	10.6M
UI019p3D3	0.98	0.6M	0.2M	0.2M	0.1M	0.0M	0.68%	0.4M	0.6M	100.0%	0.0%	6.1%	0.6M	0.0bp	1.0M	1.0M	100.0%	16.6%	9.2M	8.7M	94.7%	7.5M	80.9%	1.3M	1.0M	8.9%	76.1%	41.0%	151bp	151bp	27%	13.0M	85.8%	1076.1Mb	11.0M	39.4%	85.0%	35.9%	141.0bp	87.9%	39.0%	114bp	141bp	27%	11.0M
UI019p3D4	0.86	0.6M	0.2M	0.1M	0.1M	0.0M	0.72%	0.6M	0.6M	100.0%	0.0%	8.0%	0.6M	0.0bp	1.2M	1.2M	100.0%	12.6%	9.6M	8.8M	92.1%	7.3M	76.4%	1.5M	1.2M	9.4%	73.3%	44.0%	151bp	151bp	27%	14.2M	85.7%	1046.8Mb	10.9M	39.8%	77.3%	40.4%	141.0bp	86.8%	39.0%	112bp	141bp	18%	10.9M
UI019p3D5	0.75	0.6M	0.2M	0.1M	0.1M	0.0M	0.71%	0.6M	0.6M	100.0%	0.0%	9.3%	0.6M	0.0bp	1.2M	1.2M	100.0%	14.9%	12.3M	11.1M	89.9%	9.2M	74.9%	1.8M	1.2M	7.6%	74.5%	45.0%	151bp	151bp	27%	20.4M	85.9%	1343.9Mb	14.5M	39.6%	71.2%	47.5%	141.0bp	88.3%	39.0%	108bp	137bp	18%	14.5M
UI019p3D6	0.80	0.9M	0.4M	0.2M	0.1M	0.1M	0.64%	0.7M	0.9M	100.0%	0.0%	6.8%	0.9M	0.0bp	1.7M	1.7M	100.0%	15.2%	14.4M	13.4M	92.7%	11.3M	78.4%	2.1M	1.7M	9.1%	74.2%	42.0%	151bp	151bp	27%	22.3M	86.1%	1635.5Mb	17.0M	38.9%	76.5%	40.5%	141.0bp	87.6%	38.0%	112bp	141bp	18%	17.0M
UI019p4A1	0.88	0.5M	0.1M	0.1M	0.1M	0.0M	0.78%	0.5M	0.5M	100.0%	0.0%	10.2%	0.5M	0.0bp	1.0M	1.0M	100.0%	14.5%	9.2M	8.1M	87.9%	6.7M	72.8%	1.4M	1.0M	8.4%	70.5%	46.0%	151bp	151bp	27%	15.8M	85.3%	986.6Mb	10.7M	39.7%	68.1%	47.9%	141.0bp	86.4%	39.0%	108bp	137bp	18%	10.7M
UI019p4A2	0.79	0.5M	0.1M	0.1M	0.1M	0.0M	0.77%	0.5M	0.5M	100.0%	0.0%	10.3%	0.5M	0.0bp	1.0M	1.0M	100.0%	13.2%	10.4M	9.2M	88.8%	7.6M	73.6%	1.6M	1.0M	7.4%	73.4%	45.0%	151bp	151bp	27%	16.9M	86.0%	1106.8Mb	12.0M	39.7%	70.9%	48.3%	141.0bp	87.4%	39.0%	108bp	137bp	18%	12.0M
UI019p4A3	1.06	0.6M	0.2M	0.1M	0.1M	0.0M	0.75%	0.5M	0.6M	100.0%	0.0%	8.6%	0.6M	0.0bp	1.1M	1.1M	100.0%	12.9%	9.8M	9.0M	91.0%	7.5M	76.4%	1.4M	1.1M	8.6%	72.2%	44.0%	151bp	151bp	27%	15.4M	85.5%	1061.9Mb	11.3M	39.7%	73.3%	45.2%	141.0bp	86.7%	39.0%	110bp	137bp	18%	11.3M
UI019p4A4	0.73	0.6M	0.2M	0.2M	0.1M	0.0M	0.70%	0.5M	0.6M	100.0%	0.0%	6.4%	0.6M	0.0bp	1.1M	1.1M	100.0%	12.8%	10.7M	10.0M	94.2%	8.6M	80.5%	1.5M	1.1M	8.0%	77.9%	40.0%	151bp	151bp	27%	14.6M	86.5%	1217.9Mb	12.2M	38.6%	84.0%	34.4%	141.0bp	88.3%	38.0%	115bp	141bp	18%	12.2M
UI019p4A5	0.72	0.7M	0.3M	0.2M	0.1M	0.0M	0.68%	0.5M	0.7M	100.0%	0.0%	6.4%	0.7M	0.0bp	1.3M	1.3M	100.0%	13.5%	11.2M	10.6M	93.9%	8.9M	79.5%	1.6M	1.3M	8.9%	73.4%	42.0%	151bp	151bp	27%	16.1M	86.0%	1292.7Mb	13.0M	39.4%	80.5%	35.8%	141.0bp	87.3%	39.0%	116bp	141bp	18%	13.0M
UI019p4A6	1.02	0.7M	0.2M	0.2M	0.1M	0.0M	0.70%	0.8M	0.7M	100.0%	0.0%	9.3%	0.7M	0.0bp	1.5M	1.5M	100.0%	14.5%	8.9M	7.5M	83.9%	6.1M	68.1%	1.4M	1.5M	12.7%	64.4%	49.0%	151bp	151bp	36%	18.8M	83.9%	912.6Mb	10.4M	39.5%	55.5%	55.7%	141.0bp	80.6%	39.0%	104bp	127bp	18%	10.4M
UI074p5B1	1.12	1.2M	0.4M	0.4M	0.1M	0.1M	0.62%	0.9M	1.2M	100.0%	0.0%	6.1%	1.2M	0.0bp	2.1M	2.1M	100.0%	14.5%	6.2M	5.4M	85.9%	4.4M	70.7%	1.0M	2.1M	25.9%	50.8%	48.0%	151bp	151bp	27%	13.8M	84.4%	621.4Mb	7.3M	39.4%	52.9%	62.5%	141.0bp	70.2%	39.0%	101bp	117bp	18%	7.3M
UI074p5B2	1.13	1.3M	0.5M	0.4M	0.1M	0.1M	0.63%	0.8M	1.3M	100.0%	0.0%	5.4%	1.3M	0.0bp	2.1M	2.1M	100.0%	14.0%	8.1M	7.4M	91.2%	6.2M	76.4%	1.2M	2.1M	19.6%	57.7%	47.0%	151bp	151bp	27%	15.2M	85.5%	846.6Mb	9.5M	39.8%	62.4%	55.8%	141.0bp	76.6%	39.0%	105bp	127bp	18%	9.5M
UI074p5B3	1.07	1.6M	0.6M	0.5M	0.2M	0.1M	0.60%	1.0M	1.6M	100.0%	0.0%	5.1%	1.6M	0.0bp	2.6M	2.6M	100.0%	13.0%	9.6M	8.7M	89.9%	7.2M	75.2%	1.4M	2.6M	20.7%	56.7%	47.0%	151bp	151bp	27%	18.1M	85.4%	982.9Mb	11.1M	39.8%	61.3%	56.9%	141.0bp	74.8%	39.0%	104bp	122bp	18%	11.1M
UI074p5B4	1.08	1.3M	0.5M	0.4M	0.1M	0.1M	0.61%	0.8M	1.3M	100.0%	0.0%	5.1%	1.3M	0.0bp	2.2M	2.2M	100.0%	13.7%	8.5M	7.6M	89.7%	6.4M	75.7%	1.2M	2.2M	20.1%	56.8%	47.0%	151bp	151bp	27%	15.9M	85.4%	900.3Mb	9.8M	39.8%	61.6%	53.8%	141.0bp	75.8%	39.0%	108bp	132bp	18%	9.8M
UI074p5B5	1.16	1.0M	0.4M	0.3M	0.1M	0.1M	0.63%	0.8M	1.0M	100.0%	0.0%	6.7%	1.0M	0.0bp	1.8M	1.8M	100.0%	10.2%	9.8M	8.1M	83.1%	6.7M	68.9%	1.4M	1.8M	15.0%	58.7%	51.0%	151bp	151bp	27%	23.8M	85.1%	957.2Mb	10.9M	40.4%	45.7%	64.0%	141.0bp	77.3%	40.0%	103bp	122bp	18%	10.9M
UI074p5B6	1.20	0.8M	0.3M	0.2M	0.1M	0.0M	0.65%	0.5M	0.8M	100.0%	0.0%	6.1%	0.8M	0.0bp	1.3M	1.3M	100.0%	10.4%	6.5M	5.8M	88.8%	4.9M	74.7%	0.9M	1.3M	15.7%	57.5%	51.0%	151bp	151bp	27%	15.0M	86.0%	667.0Mb	7.3M	40.9%	48.6%	62.1%	141.0bp	79.8%	40.0%	106bp	132bp	18%	7.3M
UI074p6B1	1.20	1.3M	0.5M	0.4M	0.1M	0.1M	0.62%	0.9M	1.3M	100.0%	0.0%	5.3%	1.3M	0.0bp	2.2M	2.2M	100.0%	14.9%	8.0M	7.1M	89.0%	5.9M	74.7%	1.1M	2.2M	21.3%	56.0%	47.0%	151bp	151bp	27%	14.8M	85.3%	845.0Mb	9.3M	39.8%	63.3%	54.1%	141.0bp	74.8%	39.0%	106bp	132bp	18%	9.3M
UI074p6B2	1.12	1.6M	0.6M	0.6M	0.2M	0.1M	0.61%	1.0M	1.6M	100.0%	0.0%	5.0%	1.6M	0.0bp	2.6M	2.6M	100.0%	12.4%	8.9M	8.0M	89.5%	6.7M	74.7%	1.3M	2.6M	22.4%	54.2%	48.0%	151bp	151bp	27%	17.5M	85.2%	879.7Mb	10.2M	40.0%	58.2%	59.5%	141.0bp	72.8%	40.0%	102bp	122bp	18%	10.2M
UI074p6B3	0.77	2.2M	0.8M	0.8M	0.2M	0.1M	0.57%	1.2M	2.2M	100.0%	0.0%	4.4%	2.2M	0.0bp	3.4M	3.4M	100.0%	13.2%	10.5M	9.6M	91.9%	8.1M	77.4%	1.5M	3.4M	24.9%	54.2%	46.0%	151bp	151bp	27%	18.1M	85.6%	1079.6Mb	12.1M	39.5%	66.6%	55.5%	141.0bp	71.5%	39.0%	105bp	127bp	18%	12.1M
UI074p6B4	0.95	1.9M	0.7M	0.6M	0.2M	0.1M	0.59%	1.1M	1.9M	100.0%	0.0%	4.5%	1.9M	0.0bp	3.0M	3.0M	100.0%	12.8%	10.9M	10.1M	92.6%	8.2M	75.1%	1.9M	3.0M	20.3%	58.5%	45.0%	151bp	151bp	27%	18.4M	85.8%	1140.8Mb	12.5M	39.6%	68.2%	54.0%	141.0bp	75.5%	39.0%	106bp	132bp	18%	12.5M
UI074p6B5	0.84	1.7M	0.7M	0.5M	0.2M	0.1M	0.59%	1.0M	1.7M	100.0%	0.0%	4.7%	1.7M	0.0bp	2.8M	2.8M	100.0%	12.8%	12.0M	10.9M	90.7%	8.9M	74.3%	2.0M	2.8M	17.8%	59.3%	47.0%	151bp	151bp	27%	22.1M	85.4%	1268.0Mb	13.7M	39.5%	62.1%	54.5%	141.0bp	76.9%	39.0%	108bp	132bp	18%	13.7M
UI074p6B6	0.88	1.7M	0.7M	0.6M	0.2M	0.1M	0.57%	0.9M	1.7M	100.0%	0.0%	4.2%	1.7M	0.0bp	2.6M	2.6M	100.0%	12.4%	9.8M	8.8M	89.8%	7.3M	74.6%	1.5M	2.6M	21.2%	56.1%	46.0%	151bp	151bp	27%	18.2M	85.1%	1035.3Mb	11.2M	38.9%	61.1%	53.6%	141.0bp	73.6%	38.0%	109bp	137bp	18%	11.2M
UI075p5C1	1.35	1.2M	0.4M	0.4M	0.1M	0.1M	0.63%	0.9M	1.2M	100.0%	0.0%	6.0%	1.2M	0.0bp	2.1M	2.1M	100.0%	13.0%	6.9M	6.0M	87.0%	5.0M	71.9%	1.0M	2.1M	23.4%	52.7%	48.0%	151bp	151bp	27%	14.3M	84.9%	692.6Mb	8.0M	39.6%	55.7%	60.1%	141.0bp	72.4%	39.0%	102bp	122bp	18%	8.0M
UI075p5C2	1.35	1.2M	0.4M	0.4M	0.1M	0.1M	0.62%	0.8M	1.2M	100.0%	0.0%	5.5%	1.2M	0.0bp	2.0M	2.0M	100.0%	13.5%	7.9M	7.2M	90.5%	5.9M	74.5%	1.3M	2.0M	18.7%	57.5%	48.0%	151bp	151bp	27%	15.2M	85.7%	817.7Mb	9.2M	39.9%	60.6%	57.5%	141.0bp	76.8%	39.0%	104bp	127bp	18%	9.2M
UI075p5C3	0.99	1.3M	0.4M	0.4M	0.1M	0.1M	0.64%	1.0M	1.3M	100.0%	0.0%	6.4%	1.3M	0.0bp	2.3M	2.3M	100.0%	10.7%	9.4M	8.2M	86.4%	6.7M	70.8%	1.5M	2.3M	18.1%	57.4%	49.0%	151bp	151bp	27%	19.5M	85.0%	912.0Mb	10.6M	40.6%	54.4%	61.5%	141.0bp	75.8%	40.0%	101bp	117bp	18%	10.6M
UI075p5C4	1.12	1.8M	0.7M	0.6M	0.2M	0.1M	0.60%	1.1M	1.8M	100.0%	0.0%	5.0%	1.8M	0.0bp	2.8M	2.8M	100.0%	12.9%	14.6M	13.5M	92.6%	11.4M	78.0%	2.1M	2.8M	15.0%	64.6%	45.0%	151bp	151bp	27%	24.8M	86.3%	1544.2Mb	16.7M	39.7%	67.4%	52.8%	141.0bp	81.2%	39.0%	107bp	132bp	18%	16.7M
UI075p5C5	1.15	1.0M	0.3M	0.3M	0.1M	0.1M	0.63%	0.7M	1.0M	100.0%	0.0%	6.2%	1.0M	0.0bp	1.7M	1.7M	100.0%	10.0%	8.5M	7.5M	88.6%	6.3M	74.1%	1.2M	1.7M	15.2%	59.6%	49.0%	151bp	151bp	27%	17.8M	86.1%	851.2Mb	9.5M	40.6%	53.3%	61.5%	141.0bp	79.5%	40.0%	104bp	127bp	18%	9.5M
UI075p5C6	1.10	0.9M	0.4M	0.3M	0.1M	0.1M	0.61%	0.6M	0.9M	100.0%	0.0%	5.4%	0.9M	0.0bp	1.5M	1.5M	100.0%	12.0%	8.3M	7.3M	88.6%	6.2M	75.0%	1.1M	1.5M	14.9%	59.1%	49.0%	151bp	151bp	27%	18.5M	85.9%	876.8Mb	9.4M	39.7%	50.8%	58.4%	141.0bp	80.3%	39.0%	109bp	137bp	18%	9.4M
UI075p6C1	1.04	1.4M	0.5M	0.5M	0.1M	0.1M	0.61%	0.9M	1.4M	100.0%	0.0%	5.5%	1.4M	0.0bp	2.3M	2.3M	100.0%	14.0%	8.1M	7.2M	88.8%	6.0M	74.3%	1.2M	2.3M	22.2%	55.5%	46.0%	151bp	151bp	27%	15.0M	84.9%	850.7Mb	9.5M	38.7%	62.9%	54.1%	141.0bp	73.4%	38.0%	106bp	132bp	18%	9.5M
UI075p6C2	1.08	1.5M	0.5M	0.5M	0.2M	0.1M	0.61%	0.9M	1.5M	100.0%	0.0%	5.2%	1.5M	0.0bp	2.4M	2.4M	100.0%	10.8%	9.5M	8.7M	91.2%	7.3M	76.3%	1.4M	2.4M	19.0%	58.6%	48.0%	151bp	151bp	27%	17.4M	86.4%	943.2Mb	10.7M	40.6%	61.6%	59.8%	141.0bp	76.6%	40.0%	102bp	122bp	18%	10.7M
UI075p6C3	1.15	1.6M	0.6M	0.6M	0.2M	0.1M	0.58%	1.0M	1.6M	100.0%	0.0%	5.2%	1.6M	0.0bp	2.6M	2.6M	100.0%	10.2%	8.9M	8.0M	89.8%	6.5M	73.7%	1.4M	2.6M	22.0%	55.8%	47.0%	151bp	151bp	27%	16.7M	86.2%	870.3Mb	9.9M	39.9%	59.1%	60.3%	141.0bp	73.5%	39.0%	102bp	122bp	18%	9.9M
UI075p6C4	1.05	1.8M	0.7M	0.6M	0.2M	0.1M	0.58%	1.0M	1.8M	100.0%	0.0%	4.5%	1.8M	0.0bp	2.9M	2.9M	100.0%	10.9%	11.4M	10.7M	93.8%	9.1M	79.6%	1.6M	2.9M	19.1%	61.0%	44.0%	151bp	151bp	27%	18.1M	86.3%	1168.5Mb	12.8M	39.9%	70.8%	54.1%	141.0bp	77.5%	39.0%	106bp	127bp	18%	12.8M
UI075p6C5	1.00	1.5M	0.6M	0.5M	0.2M	0.1M	0.59%	0.8M	1.5M	100.0%	0.0%	4.4%	1.5M	0.0bp	2.3M	2.3M	100.0%	11.2%	9.9M	9.2M	92.2%	7.8M	78.8%	1.3M	2.3M	18.6%	59.4%	46.0%	151bp	151bp	27%	16.4M	86.1%	1053.6Mb	11.2M	39.6%	68.2%	50.0%	141.0bp	76.7%	39.0%	109bp	137bp	18%	11.2M
UI075p6C6	1.01	1.3M	0.5M	0.4M	0.1M	0.1M	0.61%	0.8M	1.3M	100.0%	0.0%	4.9%	1.3M	0.0bp	2.1M	2.1M	100.0%	11.4%	13.8M	12.7M	92.0%	10.9M	78.9%	1.8M	2.1M	12.3%	65.4%	48.0%	151bp	151bp	36%	23.5M	86.0%	1498.1Mb	15.6M	40.2%	66.1%	49.5%	141.0bp	82.8%	40.0%	112bp	141bp	18%	15.6M
UI076p10B1	0.83	1.3M	0.5M	0.4M	0.1M	0.1M	0.61%	0.9M	1.3M	100.0%	0.0%	5.7%	1.3M	0.0bp	2.3M	2.3M	100.0%	16.8%	13.1M	12.3M	93.6%	10.1M	77.4%	2.1M	2.3M	12.8%	70.2%	42.0%	151bp	151bp	27%	20.0M	85.8%	1431.6Mb	15.7M	39.2%	78.5%	48.1%	141.0bp	83.5%	39.0%	106bp	132bp	18%	15.7M
UI076p10B2	0.86	1.3M	0.5M	0.4M	0.1M	0.1M	0.59%	0.8M	1.3M	100.0%	0.0%	4.8%	1.3M	0.0bp	2.1M	2.1M	100.0%	16.8%	10.0M	9.5M	95.1%	8.0M	80.4%	1.5M	2.1M	15.8%	67.0%	42.0%	151bp	151bp	27%	15.1M	85.6%	1102.4Mb	12.0M	39.3%	79.5%	45.5%	141.0bp	81.5%	39.0%	108bp	132bp	18%	12.0M
UI076p10B3	0.75	1.6M	0.6M	0.5M	0.2M	0.1M	0.57%	0.9M	1.6M	100.0%	0.0%	4.5%	1.6M	0.0bp	2.5M	2.5M	100.0%	15.4%	13.4M	12.9M	96.1%	11.0M	82.0%	1.9M	2.5M	14.0%	71.8%	41.0%	151bp	151bp	27%	18.7M	86.5%	1488.9Mb	15.8M	39.4%	84.8%	43.7%	141.0bp	83.5%	39.0%	109bp	137bp	18%	15.8M
UI076p10B4	0.75	1.7M	0.7M	0.6M	0.2M	0.1M	0.59%	0.9M	1.7M	100.0%	0.0%	4.4%	1.7M	0.0bp	2.6M	2.6M	100.0%	15.0%	15.0M	14.4M	96.3%	12.2M	81.1%	2.3M	2.6M	13.2%	71.8%	41.0%	151bp	151bp	27%	20.7M	86.1%	1670.5Mb	17.7M	39.2%	85.3%	41.7%	141.0bp	83.8%	39.0%	110bp	137bp	18%	17.7M
UI076p10B5	0.76	1.7M	0.7M	0.6M	0.2M	0.1M	0.57%	1.0M	1.7M	100.0%	0.0%	4.6%	1.7M	0.0bp	2.7M	2.7M	100.0%	14.2%	18.6M	17.8M	95.8%	15.2M	81.8%	2.6M	2.7M	11.0%	73.2%	42.0%	151bp	151bp	27%	26.7M	86.5%	2037.1Mb	21.7M	39.7%	81.0%	45.0%	141.0bp	85.9%	39.0%	109bp	137bp	18%	21.7M
UI076p10B6	0.74	1.5M	0.6M	0.5M	0.2M	0.1M	0.57%	0.9M	1.5M	100.0%	0.0%	4.6%	1.5M	0.0bp	2.4M	2.4M	100.0%	14.2%	16.9M	16.1M	95.6%	13.7M	81.4%	2.4M	2.4M	10.9%	74.1%	41.0%	151bp	151bp	27%	23.1M	86.5%	1907.7Mb	19.7M	39.6%	85.3%	40.1%	141.0bp	85.7%	39.0%	112bp	137bp	18%	19.7M
UI076p10C1	0.90	1.2M	0.4M	0.4M	0.1M	0.1M	0.60%	0.8M	1.2M	100.0%	0.0%	6.0%	1.2M	0.0bp	2.0M	2.0M	100.0%	16.5%	9.8M	9.1M	92.5%	7.5M	76.2%	1.6M	2.0M	15.0%	64.7%	45.0%	151bp	151bp	27%	16.8M	85.7%	1053.1Mb	11.8M	39.6%	70.4%	52.6%	141.0bp	81.2%	39.0%	104bp	127bp	18%	11.8M
UI076p10C2	0.89	1.0M	0.4M	0.3M	0.1M	0.1M	0.59%	0.8M	1.0M	100.0%	0.0%	6.0%	1.0M	0.0bp	1.8M	1.8M	100.0%	17.5%	10.5M	9.8M	93.4%	8.1M	76.7%	1.8M	1.8M	12.3%	69.5%	43.0%	151bp	151bp	27%	17.2M	85.8%	1156.0Mb	12.7M	39.0%	73.8%	49.8%	141.0bp	84.0%	38.0%	106bp	132bp	18%	12.7M
UI076p10C3	0.87	1.6M	0.6M	0.5M	0.2M	0.1M	0.57%	0.9M	1.6M	100.0%	0.0%	4.6%	1.6M	0.0bp	2.5M	2.5M	100.0%	16.0%	12.7M	12.1M	95.9%	10.4M	81.9%	1.8M	2.5M	14.7%	70.7%	41.0%	151bp	151bp	27%	17.9M	86.3%	1407.1Mb	15.1M	39.4%	84.2%	44.3%	141.0bp	82.8%	39.0%	108bp	137bp	18%	15.1M
UI076p10C4	0.83	1.6M	0.6M	0.6M	0.2M	0.1M	0.56%	0.9M	1.6M	100.0%	0.0%	4.3%	1.6M	0.0bp	2.5M	2.5M	100.0%	15.7%	13.3M	12.7M	96.0%	10.9M	82.5%	1.8M	2.5M	14.4%	71.6%	42.0%	151bp	151bp	27%	18.3M	86.2%	1496.7Mb	15.7M	39.8%	86.1%	40.7%	141.0bp	82.7%	39.0%	110bp	137bp	18%	15.7M
UI076p10C5	0.79	1.3M	0.5M	0.4M	0.1M	0.1M	0.59%	0.7M	1.3M	100.0%	0.0%	4.7%	1.3M	0.0bp	2.0M	2.0M	100.0%	15.8%	12.2M	11.6M	95.3%	9.8M	80.2%	1.8M	2.0M	12.2%	72.0%	44.0%	151bp	151bp	27%	17.9M	86.4%	1355.1Mb	14.5M	40.5%	81.0%	46.0%	141.0bp	84.5%	40.0%	108bp	137bp	18%	14.5M
UI076p10C6	0.83	1.2M	0.5M	0.4M	0.1M	0.1M	0.58%	0.7M	1.2M	100.0%	0.0%	4.8%	1.2M	0.0bp	1.9M	1.9M	100.0%	15.2%	11.8M	11.1M	94.1%	9.4M	79.5%	1.7M	1.9M	12.4%	70.0%	44.0%	151bp	151bp	27%	18.5M	86.1%	1328.6Mb	14.0M	40.1%	75.6%	45.6%	141.0bp	83.9%	40.0%	111bp	137bp	18%	14.0M
UIDMSOp1A1	0.91	1.1M	0.4M	0.3M	0.1M	0.1M	0.60%	0.8M	1.1M	100.0%	0.0%	5.9%	1.1M	0.0bp	1.8M	1.8M	100.0%	15.5%	9.1M	8.4M	91.3%	6.9M	75.5%	1.4M	1.8M	14.7%	64.7%	46.0%	151bp	151bp	27%	16.6M	85.6%	979.7Mb	10.8M	39.5%	65.2%	53.4%	141.0bp	81.4%	39.0%	106bp	132bp	18%	10.8M
UIDMSOp1A2	0.77	0.8M	0.3M	0.2M	0.1M	0.1M	0.66%	0.7M	0.8M	100.0%	0.0%	6.9%	0.8M	0.0bp	1.5M	1.5M	100.0%	14.8%	11.6M	10.5M	90.6%	8.8M	75.8%	1.7M	1.5M	9.9%	70.5%	44.0%	151bp	151bp	27%	19.7M	85.2%	1249.7Mb	13.6M	39.3%	69.1%	49.0%	141.0bp	85.1%	39.0%	108bp	137bp	18%	13.6M
UIDMSOp1A3	1.11	1.0M	0.3M	0.3M	0.1M	0.1M	0.64%	0.7M	1.0M	100.0%	0.0%	6.3%	1.0M	0.0bp	1.7M	1.7M	100.0%	14.8%	12.2M	11.3M	92.9%	9.3M	76.6%	2.0M	1.7M	10.2%	70.7%	45.0%	151bp	151bp	27%	19.9M	86.1%	1323.9Mb	14.3M	40.0%	72.0%	49.5%	141.0bp	85.6%	39.0%	108bp	137bp	18%	14.3M
UIDMSOp1A4	0.81	1.0M	0.4M	0.3M	0.1M	0.1M	0.62%	0.8M	1.0M	100.0%	0.0%	6.1%	1.0M	0.0bp	1.8M	1.8M	100.0%	15.6%	11.5M	10.6M	91.7%	8.8M	76.1%	1.8M	1.8M	11.7%	69.4%	43.0%	151bp	151bp	27%	18.8M	85.5%	1267.1Mb	13.6M	38.8%	72.7%	47.2%	141.0bp	83.6%	38.0%	109bp	137bp	18%	13.6M
UIDMSOp1A5	0.84	1.2M	0.5M	0.4M	0.1M	0.1M	0.59%	0.7M	1.2M	100.0%	0.0%	4.9%	1.2M	0.0bp	1.9M	1.9M	100.0%	14.6%	10.7M	10.0M	93.4%	8.5M	79.6%	1.5M	1.9M	13.8%	67.6%	45.0%	151bp	151bp	27%	16.5M	86.0%	1181.1Mb	12.5M	40.5%	75.8%	45.6%	141.0bp	82.3%	40.0%	110bp	137bp	18%	12.5M
UIDMSOp1A6	0.82	1.7M	0.6M	0.6M	0.2M	0.1M	0.58%	1.2M	1.7M	100.0%	0.0%	6.4%	1.7M	0.0bp	2.9M	2.9M	100.0%	12.0%	15.0M	12.8M	85.7%	10.5M	70.1%	2.3M	2.9M	14.6%	66.0%	50.0%	151bp	151bp	27%	34.8M	85.0%	1385.6Mb	17.0M	40.5%	48.9%	67.9%	141.0bp	79.8%	40.0%	96bp	97bp	18%	17.0M
UIDMSOp2A1	0.92	0.8M	0.3M	0.3M	0.1M	0.0M	0.69%	0.8M	0.8M	100.0%	0.0%	7.9%	0.8M	0.0bp	1.6M	1.6M	100.0%	12.3%	12.0M	10.8M	90.5%	9.0M	75.4%	1.8M	1.6M	9.9%	70.2%	46.0%	151bp	151bp	27%	20.7M	85.6%	1230.0Mb	13.6M	39.7%	65.8%	53.3%	141.0bp	85.5%	39.0%	105bp	132bp	18%	13.6M
UIDMSOp2A2	0.93	1.5M	0.5M	0.5M	0.2M	0.1M	0.60%	0.9M	1.5M	100.0%	0.0%	5.0%	1.5M	0.0bp	2.4M	2.4M	100.0%	15.5%	11.8M	11.2M	94.7%	9.3M	78.6%	1.9M	2.4M	14.7%	68.1%	42.0%	151bp	151bp	27%	17.4M	85.8%	1290.9Mb	14.0M	39.7%	80.8%	46.7%	141.0bp	81.9%	39.0%	107bp	137bp	18%	14.0M
UIDMSOp2A3	0.95	1.2M	0.4M	0.4M	0.1M	0.1M	0.61%	0.8M	1.2M	100.0%	0.0%	5.9%	1.2M	0.0bp	2.1M	2.1M	100.0%	13.8%	13.1M	12.0M	91.8%	10.1M	77.2%	1.9M	2.1M	11.7%	68.6%	46.0%	151bp	151bp	27%	22.5M	85.9%	1381.2Mb	15.2M	40.3%	67.6%	52.8%	141.0bp	83.3%	40.0%	106bp	132bp	18%	15.2M
UIDMSOp2A4	0.76	1.6M	0.6M	0.5M	0.2M	0.1M	0.59%	1.0M	1.6M	100.0%	0.0%	4.8%	1.6M	0.0bp	2.6M	2.6M	100.0%	16.2%	12.7M	12.0M	94.3%	10.0M	78.7%	2.0M	2.6M	15.0%	66.9%	44.0%	151bp	151bp	27%	19.7M	85.2%	1400.0Mb	15.1M	39.7%	76.6%	46.0%	141.0bp	81.5%	39.0%	109bp	137bp	18%	15.1M
UIDMSOp2A5	0.70	1.4M	0.5M	0.5M	0.2M	0.1M	0.58%	0.8M	1.4M	100.0%	0.0%	4.4%	1.4M	0.0bp	2.2M	2.2M	100.0%	13.3%	11.6M	11.0M	95.2%	9.5M	82.0%	1.5M	2.2M	14.8%	67.8%	43.0%	151bp	151bp	27%	17.1M	86.6%	1276.3Mb	13.3M	40.1%	78.1%	45.3%	141.0bp	82.2%	40.0%	111bp	137bp	18%	13.3M
UIDMSOp2A6	1.01	1.4M	0.5M	0.5M	0.2M	0.1M	0.56%	1.0M	1.4M	100.0%	0.0%	5.7%	1.4M	0.0bp	2.4M	2.4M	100.0%	11.6%	12.3M	10.7M	87.0%	8.7M	70.8%	2.0M	2.4M	14.7%	65.6%	52.0%	151bp	151bp	27%	30.3M	85.5%	1131.1Mb	13.9M	41.0%	45.7%	69.5%	141.0bp	79.9%	40.0%	95bp	92bp	18%	13.9M
UIDMSOp3A1	0.74	1.1M	0.5M	0.3M	0.1M	0.1M	0.59%	0.6M	1.1M	100.0%	0.0%	4.6%	1.1M	0.0bp	1.8M	1.8M	100.0%	14.5%	10.1M	9.6M	94.7%	8.2M	80.7%	1.4M	1.8M	13.6%	70.1%	43.0%	151bp	151bp	27%	14.4M	85.8%	1154.4Mb	11.9M	39.4%	82.6%	38.0%	141.0bp	82.9%	39.0%	113bp	141bp	18%	11.9M
UIDMSOp3A2	0.74	0.9M	0.4M	0.3M	0.1M	0.1M	0.62%	0.5M	0.9M	100.0%	0.0%	4.5%	0.9M	0.0bp	1.5M	1.5M	100.0%	14.1%	13.0M	12.5M	95.8%	10.6M	81.7%	1.8M	1.5M	8.8%	76.0%	41.0%	151bp	151bp	27%	18.0M	86.4%	1503.2Mb	15.1M	39.3%	84.1%	35.1%	141.0bp	87.7%	39.0%	115bp	141bp	18%	15.1M
UIDMSOp3A3	0.90	0.8M	0.3M	0.2M	0.1M	0.1M	0.64%	0.6M	0.8M	100.0%	0.0%	5.5%	0.8M	0.0bp	1.4M	1.4M	100.0%	11.1%	11.6M	10.9M	94.0%	9.4M	80.5%	1.6M	1.4M	9.2%	72.1%	44.0%	151bp	151bp	27%	16.9M	86.5%	1267.4Mb	13.1M	40.1%	77.6%	43.6%	141.0bp	86.5%	40.0%	112bp	141bp	18%	13.1M
UIDMSOp3A4	0.74	0.6M	0.3M	0.1M	0.1M	0.0M	0.67%	0.4M	0.6M	100.0%	0.0%	4.9%	0.6M	0.0bp	0.9M	0.9M	100.0%	14.0%	12.6M	12.1M	95.8%	10.3M	81.8%	1.8M	0.9M	5.9%	80.8%	39.0%	151bp	151bp	27%	16.7M	86.2%	1497.3Mb	14.6M	38.2%	87.7%	28.6%	141.0bp	90.2%	38.0%	119bp	141bp	18%	14.6M
UIDMSOp3A5	0.79	0.9M	0.3M	0.2M	0.1M	0.1M	0.62%	0.5M	0.9M	100.0%	0.0%	4.9%	0.9M	0.0bp	1.4M	1.4M	100.0%	13.8%	13.1M	12.4M	94.6%	10.6M	81.1%	1.8M	1.4M	8.3%	74.1%	42.0%	151bp	151bp	27%	19.5M	86.8%	1476.2Mb	15.2M	39.5%	77.7%	42.2%	141.0bp	87.8%	39.0%	112bp	141bp	18%	15.2M
UIDMSOp3A6	0.81	1.0M	0.4M	0.3M	0.1M	0.1M	0.61%	0.6M	1.0M	100.0%	0.0%	5.3%	1.0M	0.0bp	1.6M	1.6M	100.0%	13.4%	13.4M	12.2M	91.1%	10.4M	77.5%	1.8M	1.6M	9.5%	70.2%	45.0%	151bp	151bp	27%	23.2M	85.3%	1466.8Mb	15.4M	39.0%	66.7%	47.8%	141.0bp	85.0%	38.0%	111bp	137bp	18%	15.4M
UIDMSOp4A1	0.99	1.0M	0.4M	0.3M	0.1M	0.1M	0.62%	0.6M	1.0M	100.0%	0.0%	5.1%	1.0M	0.0bp	1.6M	1.6M	100.0%	13.3%	11.3M	10.7M	94.8%	9.2M	81.6%	1.5M	1.6M	11.2%	72.3%	41.0%	151bp	151bp	27%	15.9M	85.8%	1280.4Mb	13.1M	38.5%	82.0%	36.5%	141.0bp	85.4%	38.0%	114bp	141bp	18%	13.1M
UIDMSOp4A2	0.81	1.3M	0.5M	0.4M	0.1M	0.1M	0.59%	0.7M	1.3M	100.0%	0.0%	4.4%	1.3M	0.0bp	2.0M	2.0M	100.0%	12.8%	12.4M	11.9M	95.8%	10.3M	82.7%	1.6M	2.0M	12.5%	72.1%	39.0%	151bp	151bp	27%	16.8M	86.4%	1417.7Mb	14.3M	38.7%	85.1%	35.4%	141.0bp	84.7%	38.0%	115bp	141bp	18%	14.3M
UIDMSOp4A3	0.66	1.1M	0.4M	0.3M	0.1M	0.1M	0.63%	0.7M	1.1M	100.0%	0.0%	5.1%	1.1M	0.0bp	1.7M	1.7M	100.0%	13.4%	14.7M	14.0M	95.3%	12.1M	82.1%	2.0M	1.7M	9.2%	74.0%	42.0%	151bp	151bp	27%	20.8M	85.9%	1657.2Mb	17.0M	39.1%	81.7%	37.1%	141.0bp	87.1%	39.0%	114bp	141bp	18%	17.0M
UIDMSOp4A4	0.82	1.0M	0.4M	0.3M	0.1M	0.1M	0.64%	0.6M	1.0M	100.0%	0.0%	4.7%	1.0M	0.0bp	1.6M	1.6M	100.0%	14.0%	14.9M	14.3M	95.9%	12.2M	81.9%	2.1M	1.6M	8.2%	76.7%	40.0%	151bp	151bp	27%	20.3M	85.9%	1752.1Mb	17.4M	38.7%	85.7%	30.2%	141.0bp	88.4%	38.0%	118bp	141bp	18%	17.4M
UIDMSOp4A5	0.72	1.2M	0.5M	0.3M	0.1M	0.1M	0.63%	0.8M	1.2M	100.0%	0.0%	5.7%	1.2M	0.0bp	2.1M	2.1M	100.0%	14.0%	15.4M	14.1M	91.6%	11.8M	76.6%	2.3M	2.1M	10.5%	69.0%	47.0%	151bp	151bp	36%	25.4M	84.6%	1674.3Mb	17.9M	40.0%	70.3%	46.0%	141.0bp	84.0%	39.0%	111bp	137bp	18%	17.9M
UIDMSOp4A6	0.85	1.0M	0.4M	0.3M	0.1M	0.1M	0.65%	0.9M	1.0M	100.0%	0.0%	7.4%	1.0M	0.0bp	1.9M	1.9M	100.0%	11.7%	14.7M	12.5M	84.8%	10.3M	69.8%	2.2M	1.9M	10.4%	69.0%	51.0%	151bp	151bp	27%	30.4M	84.6%	1442.7Mb	16.7M	40.9%	54.7%	60.0%	141.0bp	82.2%	40.0%	102bp	117bp	18%	16.7M
UIDMSOp5A1	3.26	0.8M	0.2M	0.2M	0.1M	0.0M	0.71%	0.9M	0.8M	100.0%	0.0%	9.7%	0.8M	0.0bp	1.7M	1.7M	100.0%	10.1%	3.8M	2.1M	55.6%	1.5M	38.9%	0.6M	1.7M	38.2%	48.7%	58.0%	151bp	151bp	27%	17.6M	78.7%	263.6Mb	4.2M	41.4%	24.2%	79.0%	141.0bp	56.8%	41.0%	79bp	77bp	45%	4.2M
UIDMSOp5A2	1.09	1.3M	0.5M	0.4M	0.1M	0.1M	0.60%	0.9M	1.3M	100.0%	0.0%	5.6%	1.3M	0.0bp	2.2M	2.2M	100.0%	14.0%	6.4M	5.5M	86.2%	4.6M	71.1%	1.0M	2.2M	26.8%	50.0%	49.0%	151bp	151bp	18%	14.6M	84.8%	640.2Mb	7.5M	39.5%	51.3%	62.1%	141.0bp	69.5%	39.0%	101bp	117bp	18%	7.5M
UIDMSOp5A3	1.31	1.4M	0.5M	0.5M	0.1M	0.1M	0.61%	0.9M	1.4M	100.0%	0.0%	5.3%	1.4M	0.0bp	2.3M	2.3M	100.0%	13.4%	7.4M	6.6M	89.1%	5.5M	74.2%	1.1M	2.3M	23.8%	53.2%	49.0%	151bp	151bp	27%	15.0M	85.0%	742.6Mb	8.5M	40.1%	56.7%	60.1%	141.0bp	72.1%	40.0%	102bp	122bp	18%	8.5M
UIDMSOp5A4	1.06	1.6M	0.6M	0.5M	0.2M	0.1M	0.59%	0.9M	1.6M	100.0%	0.0%	4.8%	1.6M	0.0bp	2.5M	2.5M	100.0%	13.9%	8.9M	8.0M	89.7%	6.7M	75.3%	1.3M	2.5M	22.2%	55.4%	49.0%	151bp	151bp	27%	17.8M	85.4%	918.2Mb	10.3M	39.9%	57.8%	59.2%	141.0bp	73.8%	39.0%	104bp	122bp	18%	10.3M
UIDMSOp5A5	1.29	0.9M	0.3M	0.3M	0.1M	0.1M	0.63%	0.7M	0.9M	100.0%	0.0%	6.4%	0.9M	0.0bp	1.6M	1.6M	100.0%	10.1%	5.6M	4.7M	83.7%	3.8M	68.5%	0.8M	1.6M	22.1%	52.1%	53.0%	151bp	151bp	27%	15.5M	84.7%	524.0Mb	6.2M	40.8%	40.1%	68.6%	141.0bp	71.8%	40.0%	99bp	112bp	18%	6.2M
UIDMSOp5A6	1.78	0.9M	0.3M	0.3M	0.1M	0.1M	0.61%	0.7M	0.9M	100.0%	0.0%	6.3%	0.9M	0.0bp	1.6M	1.6M	100.0%	9.6%	3.3M	2.3M	69.4%	1.8M	55.0%	0.5M	1.6M	43.5%	42.3%	58.0%	151bp	151bp	18%	12.3M	81.4%	276.4Mb	3.7M	41.6%	29.8%	74.7%	141.0bp	52.2%	41.0%	93bp	87bp	36%	3.7M
UIDMSOp6A1	1.06	1.4M	0.5M	0.5M	0.2M	0.1M	0.60%	0.9M	1.4M	100.0%	0.0%	5.2%	1.4M	0.0bp	2.3M	2.3M	100.0%	12.8%	6.5M	5.6M	86.3%	4.7M	72.0%	0.9M	2.3M	28.2%	49.4%	50.0%	151bp	151bp	18%	13.7M	84.8%	641.5Mb	7.4M	40.0%	54.2%	60.3%	141.0bp	67.9%	39.0%	102bp	117bp	18%	7.4M
UIDMSOp6A2	1.08	1.7M	0.6M	0.6M	0.2M	0.1M	0.60%	1.1M	1.7M	100.0%	0.0%	5.2%	1.7M	0.0bp	2.8M	2.8M	100.0%	13.9%	8.8M	7.9M	89.8%	6.6M	74.7%	1.3M	2.8M	24.1%	53.6%	47.0%	151bp	151bp	27%	17.1M	85.3%	889.0Mb	10.2M	39.6%	59.8%	59.6%	141.0bp	72.2%	39.0%	102bp	122bp	18%	10.2M
UIDMSOp6A3	1.05	1.4M	0.5M	0.5M	0.2M	0.1M	0.60%	0.9M	1.4M	100.0%	0.0%	5.5%	1.4M	0.0bp	2.3M	2.3M	100.0%	10.9%	6.9M	5.8M	84.7%	4.8M	69.7%	1.0M	2.3M	26.4%	50.2%	52.0%	151bp	151bp	27%	16.0M	84.6%	653.1Mb	7.7M	40.9%	48.4%	64.7%	141.0bp	68.2%	40.0%	100bp	107bp	18%	7.7M
UIDMSOp6A4	0.88	1.8M	0.6M	0.6M	0.2M	0.1M	0.59%	1.0M	1.8M	100.0%	0.0%	4.7%	1.8M	0.0bp	2.9M	2.9M	100.0%	12.5%	8.5M	7.5M	88.7%	6.2M	73.0%	1.3M	2.9M	26.1%	51.1%	48.0%	151bp	151bp	27%	16.4M	84.7%	862.5Mb	9.7M	39.6%	59.3%	57.2%	141.0bp	69.1%	39.0%	105bp	127bp	18%	9.7M
UIDMSOp6A5	1.28	1.3M	0.4M	0.4M	0.1M	0.1M	0.60%	0.8M	1.3M	100.0%	0.0%	5.3%	1.3M	0.0bp	2.1M	2.1M	100.0%	11.5%	6.3M	5.1M	81.8%	4.1M	64.9%	1.1M	2.1M	26.2%	53.2%	54.0%	151bp	151bp	27%	18.2M	83.6%	580.5Mb	7.1M	40.6%	39.0%	70.3%	141.0bp	67.3%	40.0%	98bp	97bp	18%	7.1M
UIDMSOp6A6	1.11	2.0M	0.7M	0.7M	0.2M	0.1M	0.56%	1.2M	2.0M	100.0%	0.0%	4.9%	2.0M	0.0bp	3.2M	3.2M	100.0%	10.9%	7.3M	6.1M	83.4%	5.0M	69.2%	1.0M	3.2M	35.4%	46.3%	52.0%	151bp	151bp	18%	18.2M	84.5%	693.7Mb	8.2M	40.1%	44.8%	66.5%	141.0bp	62.3%	40.0%	101bp	112bp	18%	8.2M
UIDMSOp7A1	0.61	1.3M	0.5M	0.4M	0.1M	0.1M	0.57%	0.7M	1.3M	100.0%	0.0%	4.0%	1.3M	0.0bp	1.9M	1.9M	100.0%	17.3%	10.0M	9.6M	96.3%	8.2M	82.4%	1.4M	1.9M	15.1%	70.9%	40.0%	151bp	151bp	27%	13.8M	86.4%	1182.9Mb	12.1M	39.2%	87.8%	36.1%	141.0bp	82.7%	39.0%	113bp	141bp	27%	12.1M
UIDMSOp7A2	0.88	1.3M	0.5M	0.4M	0.1M	0.1M	0.60%	0.7M	1.3M	100.0%	0.0%	4.1%	1.3M	0.0bp	2.0M	2.0M	100.0%	14.1%	11.7M	11.3M	96.7%	9.5M	81.5%	1.8M	2.0M	12.8%	72.8%	39.0%	151bp	151bp	27%	15.1M	86.1%	1359.9Mb	13.6M	39.2%	90.1%	31.5%	141.0bp	84.2%	39.0%	116bp	141bp	18%	13.6M
UIDMSOp7A3	0.75	1.3M	0.5M	0.4M	0.1M	0.1M	0.61%	0.7M	1.3M	100.0%	0.0%	4.6%	1.3M	0.0bp	2.0M	2.0M	100.0%	13.6%	12.6M	12.1M	96.1%	9.8M	77.8%	2.3M	2.0M	11.7%	73.5%	39.0%	151bp	151bp	27%	16.5M	85.9%	1438.7Mb	14.6M	38.8%	88.3%	33.4%	141.0bp	84.8%	38.0%	115bp	141bp	18%	14.6M
UIDMSOp7A4	0.81	1.5M	0.6M	0.4M	0.1M	0.1M	0.60%	0.7M	1.5M	100.0%	0.0%	4.0%	1.5M	0.0bp	2.2M	2.2M	100.0%	12.9%	17.5M	16.9M	97.1%	13.9M	79.7%	3.0M	2.2M	9.7%	77.7%	39.0%	151bp	151bp	27%	21.9M	86.4%	2042.7Mb	20.0M	38.9%	91.3%	27.4%	141.0bp	87.1%	38.0%	118bp	141bp	18%	20.0M
UIDMSOp7A5	0.89	1.1M	0.5M	0.3M	0.1M	0.1M	0.64%	0.7M	1.1M	100.0%	0.0%	5.3%	1.1M	0.0bp	1.8M	1.8M	100.0%	13.4%	19.2M	18.3M	95.2%	15.8M	81.9%	2.6M	1.8M	7.5%	76.8%	41.0%	151bp	151bp	27%	26.4M	86.3%	2205.7Mb	22.2M	39.3%	84.3%	35.8%	141.0bp	88.8%	39.0%	115bp	141bp	18%	22.2M
UIDMSOp7A6	0.78	1.7M	0.7M	0.5M	0.2M	0.1M	0.57%	0.9M	1.7M	100.0%	0.0%	4.0%	1.7M	0.0bp	2.6M	2.6M	100.0%	13.5%	17.5M	16.8M	95.6%	14.5M	82.6%	2.3M	2.6M	11.8%	72.7%	39.0%	151bp	151bp	27%	23.7M	86.2%	2029.1Mb	20.3M	38.4%	85.6%	34.4%	141.0bp	85.0%	38.0%	116bp	141bp	18%	20.3M
UIDMSOp8A1	0.76	1.4M	0.6M	0.4M	0.1M	0.1M	0.58%	0.7M	1.4M	100.0%	0.0%	4.3%	1.4M	0.0bp	2.1M	2.1M	100.0%	17.2%	11.0M	10.6M	95.8%	8.7M	79.0%	1.9M	2.1M	14.6%	70.6%	40.0%	151bp	151bp	27%	15.1M	85.9%	1297.7Mb	13.3M	39.5%	88.6%	35.5%	141.0bp	82.8%	39.0%	113bp	141bp	27%	13.3M
UIDMSOp8A2	0.85	1.6M	0.7M	0.5M	0.2M	0.1M	0.59%	0.9M	1.6M	100.0%	0.0%	4.2%	1.6M	0.0bp	2.5M	2.5M	100.0%	15.8%	14.0M	13.5M	96.2%	11.3M	80.8%	2.2M	2.5M	13.7%	71.8%	39.0%	151bp	151bp	27%	18.7M	85.4%	1612.8Mb	16.6M	38.6%	88.6%	34.7%	141.0bp	83.2%	38.0%	114bp	141bp	18%	16.6M
UIDMSOp8A3	0.86	0.9M	0.4M	0.3M	0.1M	0.1M	0.64%	0.5M	0.9M	100.0%	0.0%	3.9%	0.9M	0.0bp	1.4M	1.4M	100.0%	13.5%	16.7M	16.3M	97.3%	14.1M	84.5%	2.1M	1.4M	6.7%	82.1%	39.0%	151bp	151bp	27%	20.7M	86.4%	1997.9Mb	19.4M	39.3%	93.4%	26.2%	141.0bp	90.1%	39.0%	119bp	141bp	18%	19.4M
UIDMSOp8A4	0.82	1.2M	0.5M	0.3M	0.1M	0.1M	0.60%	0.6M	1.2M	100.0%	0.0%	4.4%	1.2M	0.0bp	1.8M	1.8M	100.0%	14.2%	13.3M	12.7M	96.0%	11.0M	82.5%	1.8M	1.8M	10.7%	74.7%	39.0%	151bp	151bp	27%	17.8M	86.2%	1549.2Mb	15.5M	38.7%	86.9%	32.3%	141.0bp	86.4%	38.0%	116bp	141bp	18%	15.5M
UIDMSOp8A5	0.67	1.4M	0.6M	0.4M	0.1M	0.1M	0.59%	0.8M	1.4M	100.0%	0.0%	4.3%	1.4M	0.0bp	2.2M	2.2M	100.0%	14.5%	16.4M	15.6M	95.6%	13.4M	81.6%	2.3M	2.2M	10.6%	74.0%	40.0%	151bp	151bp	27%	22.3M	86.1%	1911.1Mb	19.2M	38.9%	85.8%	33.8%	141.0bp	86.3%	38.0%	116bp	141bp	18%	19.2M
UIDMSOp8A6	0.65	1.3M	0.6M	0.4M	0.1M	0.1M	0.61%	0.7M	1.3M	100.0%	0.0%	4.3%	1.3M	0.0bp	2.0M	2.0M	100.0%	13.4%	15.7M	15.0M	95.5%	12.9M	82.0%	2.1M	2.0M	10.4%	74.4%	39.0%	151bp	151bp	27%	21.1M	86.2%	1845.3Mb	18.1M	38.6%	85.7%	30.6%	141.0bp	86.5%	38.0%	118bp	141bp	18%	18.1M
UIDMSOp10A1	0.76	1.6M	0.6M	0.5M	0.2M	0.1M	0.57%	0.9M	1.6M	100.0%	0.0%	4.8%	1.6M	0.0bp	2.5M	2.5M	100.0%	16.7%	10.5M	9.8M	93.7%	8.1M	77.5%	1.7M	2.5M	17.6%	63.7%	44.0%	151bp	151bp	27%	16.9M	85.9%	1137.9Mb	12.6M	39.5%	74.4%	50.0%	141.0bp	79.2%	39.0%	105bp	127bp	18%	12.6M
UIDMSOp10A2	0.73	1.6M	0.6M	0.5M	0.2M	0.1M	0.58%	1.0M	1.6M	100.0%	0.0%	4.8%	1.6M	0.0bp	2.6M	2.6M	100.0%	17.9%	13.0M	12.3M	94.7%	10.4M	80.1%	1.9M	2.6M	14.8%	69.6%	42.0%	151bp	151bp	27%	19.1M	86.0%	1473.5Mb	15.8M	39.5%	82.8%	43.8%	141.0bp	82.3%	39.0%	108bp	137bp	27%	15.8M
UIDMSOp10A3	0.86	1.8M	0.7M	0.6M	0.2M	0.1M	0.58%	1.1M	1.8M	100.0%	0.0%	4.9%	1.8M	0.0bp	3.0M	3.0M	100.0%	15.1%	17.7M	16.8M	95.0%	14.0M	79.2%	2.8M	3.0M	12.2%	71.5%	42.0%	151bp	151bp	27%	26.1M	86.2%	1906.2Mb	20.9M	39.3%	80.0%	48.1%	141.0bp	84.3%	39.0%	106bp	132bp	18%	20.9M
UIDMSOp10A4	0.82	2.3M	0.9M	0.8M	0.2M	0.1M	0.56%	1.3M	2.3M	100.0%	0.0%	4.6%	2.3M	0.0bp	3.5M	3.5M	100.0%	14.8%	20.1M	19.1M	95.2%	16.1M	79.9%	3.1M	3.5M	13.2%	71.2%	40.0%	151bp	151bp	27%	28.7M	86.1%	2222.9Mb	23.6M	38.7%	82.3%	42.2%	141.0bp	83.7%	38.0%	109bp	137bp	18%	23.6M
UIDMSOp10A5	0.67	1.8M	0.7M	0.6M	0.2M	0.1M	0.58%	1.0M	1.8M	100.0%	0.0%	4.4%	1.8M	0.0bp	2.8M	2.8M	100.0%	15.2%	15.6M	14.9M	95.5%	12.3M	78.8%	2.6M	2.8M	13.5%	70.4%	41.0%	151bp	151bp	27%	22.1M	86.2%	1736.9Mb	18.4M	39.6%	83.3%	43.0%	141.0bp	83.1%	39.0%	110bp	137bp	18%	18.4M
UIDMSOp10A6	0.72	1.9M	0.7M	0.7M	0.2M	0.1M	0.55%	0.9M	1.9M	100.0%	0.0%	3.9%	1.9M	0.0bp	2.9M	2.9M	100.0%	13.1%	14.1M	13.5M	95.9%	11.2M	79.6%	2.3M	2.9M	15.4%	68.3%	42.0%	151bp	151bp	27%	19.8M	86.8%	1544.2Mb	16.2M	40.0%	81.8%	44.0%	141.0bp	81.3%	39.0%	110bp	137bp	18%	16.2M
UIDMSOp11A1	0.95	2.7M	0.9M	1.1M	0.3M	0.1M	0.57%	1.4M	2.7M	100.0%	0.0%	4.1%	2.7M	0.0bp	4.1M	4.1M	100.0%	13.4%	7.6M	7.0M	91.3%	5.7M	74.3%	1.3M	4.1M	38.5%	41.9%	48.0%	151bp	151bp	18%	13.8M	84.8%	736.1Mb	8.8M	40.3%	64.0%	60.9%	141.0bp	58.3%	40.0%	98bp	107bp	18%	8.8M
UIDMSOp11A2	0.75	2.6M	0.9M	1.0M	0.3M	0.1M	0.57%	1.2M	2.6M	100.0%	0.0%	3.7%	2.6M	0.0bp	3.7M	3.7M	100.0%	12.8%	6.8M	6.3M	93.0%	5.2M	76.9%	1.1M	3.7M	40.6%	39.9%	45.0%	151bp	151bp	18%	11.0M	85.1%	679.7Mb	7.8M	39.7%	70.4%	54.8%	141.0bp	56.7%	39.0%	103bp	122bp	18%	7.8M
UIDMSOp11A3	0.96	3.0M	1.0M	1.2M	0.3M	0.2M	0.55%	1.4M	3.0M	100.0%	0.0%	3.9%	3.0M	0.0bp	4.4M	4.4M	100.0%	12.6%	10.9M	10.2M	93.1%	8.4M	77.2%	1.7M	4.4M	29.8%	50.9%	45.0%	151bp	151bp	27%	17.6M	85.8%	1084.6Mb	12.5M	39.3%	70.9%	56.3%	141.0bp	66.2%	39.0%	101bp	117bp	18%	12.5M
UIDMSOp11A4	0.96	3.1M	1.0M	1.2M	0.3M	0.2M	0.55%	1.4M	3.1M	100.0%	0.0%	3.6%	3.1M	0.0bp	4.4M	4.4M	100.0%	12.4%	9.0M	8.4M	93.8%	7.0M	78.5%	1.4M	4.4M	36.8%	44.8%	45.0%	151bp	151bp	18%	13.9M	85.4%	901.6Mb	10.2M	40.2%	73.8%	54.2%	141.0bp	60.1%	40.0%	103bp	122bp	18%	10.2M
UIDMSOp11A5	0.78	2.9M	1.0M	1.1M	0.3M	0.2M	0.56%	1.4M	2.9M	100.0%	0.0%	3.9%	2.9M	0.0bp	4.3M	4.3M	100.0%	10.0%	11.7M	10.9M	93.1%	9.0M	77.5%	1.8M	4.3M	27.4%	52.4%	46.0%	151bp	151bp	27%	19.9M	86.0%	1146.7Mb	13.0M	39.7%	65.2%	57.8%	141.0bp	68.5%	39.0%	103bp	122bp	18%	13.0M
UIDMSOp11A6	0.81	3.2M	1.1M	1.2M	0.3M	0.2M	0.54%	1.3M	3.2M	100.0%	0.0%	3.3%	3.2M	0.0bp	4.5M	4.5M	100.0%	10.6%	10.2M	9.5M	93.2%	8.0M	78.5%	1.5M	4.5M	34.1%	46.5%	45.0%	151bp	151bp	18%	16.1M	85.5%	1054.8Mb	11.4M	39.8%	71.2%	50.8%	141.0bp	62.6%	39.0%	108bp	132bp	18%	11.4M
UIMCHp11B1	0.95	3.3M	1.1M	1.3M	0.4M	0.2M	0.55%	1.5M	3.3M	100.0%	0.0%	3.7%	3.3M	0.0bp	4.9M	4.9M	100.0%	13.0%	10.9M	10.2M	93.9%	8.4M	77.2%	1.8M	4.9M	32.0%	48.5%	44.0%	151bp	151bp	18%	17.2M	85.6%	1068.1Mb	12.5M	39.4%	72.5%	57.3%	141.0bp	64.4%	39.0%	100bp	112bp	27%	12.5M
UIMCHp11B2	0.89	3.0M	1.0M	1.1M	0.3M	0.2M	0.56%	1.5M	3.0M	100.0%	0.0%	4.0%	3.0M	0.0bp	4.4M	4.4M	100.0%	13.1%	12.0M	11.2M	93.3%	9.3M	77.5%	1.9M	4.4M	26.9%	53.5%	45.0%	151bp	151bp	27%	18.4M	85.5%	1215.3Mb	13.8M	39.6%	74.7%	52.9%	141.0bp	68.5%	39.0%	103bp	122bp	18%	13.8M
UIMCHp11B3	0.90	2.7M	0.9M	1.0M	0.3M	0.1M	0.57%	1.3M	2.7M	100.0%	0.0%	4.0%	2.7M	0.0bp	4.0M	4.0M	100.0%	11.4%	11.4M	10.7M	93.2%	9.0M	78.6%	1.7M	4.0M	26.3%	54.4%	44.0%	151bp	151bp	27%	18.1M	85.9%	1147.5Mb	12.9M	39.6%	71.5%	54.5%	141.0bp	69.6%	39.0%	104bp	122bp	18%	12.9M
UIMCHp11B4	0.90	2.7M	0.9M	1.0M	0.3M	0.2M	0.57%	1.4M	2.7M	100.0%	0.0%	4.1%	2.7M	0.0bp	4.1M	4.1M	100.0%	11.8%	13.8M	12.9M	93.7%	11.0M	79.6%	1.9M	4.1M	22.6%	58.8%	45.0%	151bp	151bp	27%	20.9M	85.9%	1415.1Mb	15.6M	39.9%	74.6%	52.2%	141.0bp	73.8%	39.0%	105bp	127bp	18%	15.6M
UIMCHp11B5	0.84	2.4M	0.8M	0.9M	0.2M	0.1M	0.56%	1.1M	2.4M	100.0%	0.0%	3.8%	2.4M	0.0bp	3.5M	3.5M	100.0%	10.4%	10.8M	10.1M	93.6%	8.5M	78.8%	1.6M	3.5M	24.5%	55.3%	46.0%	151bp	151bp	27%	17.0M	86.2%	1100.9Mb	12.1M	40.3%	70.9%	53.0%	141.0bp	71.3%	40.0%	106bp	132bp	18%	12.1M
UIMCHp11B6	0.78	2.6M	0.9M	1.0M	0.3M	0.2M	0.55%	1.1M	2.6M	100.0%	0.0%	3.5%	2.6M	0.0bp	3.7M	3.7M	100.0%	10.3%	11.2M	10.6M	94.6%	9.1M	81.0%	1.5M	3.7M	25.4%	55.1%	43.0%	151bp	151bp	27%	16.9M	86.3%	1163.2Mb	12.5M	39.6%	74.0%	51.2%	141.0bp	71.1%	39.0%	108bp	132bp	18%	12.5M
UIMCHp11C1	0.90	3.6M	1.2M	1.4M	0.4M	0.2M	0.56%	1.9M	3.6M	100.0%	0.0%	4.1%	3.6M	0.0bp	5.5M	5.5M	100.0%	12.6%	14.2M	13.1M	92.5%	10.7M	75.5%	2.4M	5.5M	27.6%	51.8%	47.0%	151bp	151bp	27%	24.8M	85.4%	1375.7Mb	16.2M	39.8%	65.5%	60.2%	141.0bp	67.8%	39.0%	99bp	107bp	18%	16.2M
UIMCHp11C2	0.85	2.9M	1.0M	1.2M	0.3M	0.2M	0.57%	1.4M	2.9M	100.0%	0.0%	4.0%	2.9M	0.0bp	4.3M	4.3M	100.0%	14.1%	12.1M	11.3M	93.6%	9.6M	79.0%	1.8M	4.3M	26.5%	54.7%	43.0%	151bp	151bp	27%	18.8M	85.8%	1259.9Mb	14.1M	39.3%	74.9%	52.6%	141.0bp	70.2%	39.0%	104bp	122bp	18%	14.1M
UIMCHp11C3	0.83	2.5M	0.9M	0.9M	0.3M	0.1M	0.58%	1.2M	2.5M	100.0%	0.0%	4.1%	2.5M	0.0bp	3.7M	3.7M	100.0%	11.9%	10.8M	10.2M	94.0%	8.6M	79.3%	1.6M	3.7M	25.7%	55.3%	46.0%	151bp	151bp	27%	16.9M	85.8%	1094.1Mb	12.3M	40.2%	72.7%	53.8%	141.0bp	70.7%	40.0%	104bp	127bp	18%	12.3M
UIMCHp11C4	0.79	3.3M	1.1M	1.3M	0.3M	0.2M	0.55%	1.4M	3.3M	100.0%	0.0%	3.4%	3.3M	0.0bp	4.7M	4.7M	100.0%	11.3%	11.2M	10.6M	95.0%	8.9M	79.8%	1.7M	4.7M	30.8%	50.6%	43.0%	151bp	151bp	27%	16.5M	86.0%	1138.0Mb	12.6M	39.5%	76.3%	51.3%	141.0bp	65.7%	39.0%	105bp	127bp	18%	12.6M
UIMCHp11C5	0.81	3.1M	1.1M	1.2M	0.3M	0.2M	0.55%	1.4M	3.1M	100.0%	0.0%	3.6%	3.1M	0.0bp	4.4M	4.4M	100.0%	11.1%	10.9M	10.3M	94.5%	8.8M	80.2%	1.6M	4.4M	30.4%	50.5%	44.0%	151bp	151bp	27%	16.8M	86.0%	1100.7Mb	12.3M	39.7%	73.1%	53.8%	141.0bp	66.2%	39.0%	104bp	122bp	18%	12.3M
UIMCHp11C6	0.79	3.2M	1.2M	1.2M	0.3M	0.2M	0.54%	1.5M	3.2M	100.0%	0.0%	3.7%	3.2M	0.0bp	4.7M	4.7M	100.0%	10.9%	12.9M	11.8M	91.8%	9.9M	77.2%	1.9M	4.7M	28.3%	52.2%	43.0%	151bp	151bp	27%	20.9M	85.8%	1332.9Mb	14.5M	38.7%	69.3%	52.1%	141.0bp	67.8%	38.0%	107bp	132bp	18%	14.5M
UIfop7C1	0.74	1.3M	0.5M	0.3M	0.1M	0.1M	0.60%	0.7M	1.3M	100.0%	0.0%	4.6%	1.3M	0.0bp	2.0M	2.0M	100.0%	16.2%	11.4M	10.9M	96.0%	9.3M	81.8%	1.6M	2.0M	13.5%	71.4%	40.0%	151bp	151bp	27%	15.9M	86.0%	1329.2Mb	13.6M	39.5%	85.6%	34.6%	141.0bp	84.2%	39.0%	114bp	141bp	27%	13.6M
UIfop7C2	0.79	1.3M	0.6M	0.4M	0.1M	0.1M	0.59%	0.7M	1.3M	100.0%	0.0%	4.2%	1.3M	0.0bp	2.0M	2.0M	100.0%	18.3%	12.4M	12.0M	96.4%	10.2M	82.0%	1.8M	2.0M	12.7%	74.2%	40.0%	151bp	151bp	27%	17.0M	85.6%	1485.9Mb	15.2M	39.6%	89.4%	32.7%	141.0bp	85.4%	39.0%	114bp	141bp	27%	15.2M
UIfop7C3	0.77	1.0M	0.4M	0.3M	0.1M	0.1M	0.64%	0.6M	1.0M	100.0%	0.0%	5.0%	1.0M	0.0bp	1.7M	1.7M	100.0%	14.3%	10.7M	10.3M	95.8%	8.2M	76.4%	2.1M	1.7M	11.3%	72.8%	41.0%	151bp	151bp	27%	14.7M	86.0%	1213.0Mb	12.5M	39.9%	85.3%	38.0%	141.0bp	85.0%	39.0%	112bp	141bp	27%	12.5M
UIfop7C4	0.89	1.0M	0.4M	0.2M	0.1M	0.1M	0.64%	0.6M	1.0M	100.0%	0.0%	4.6%	1.0M	0.0bp	1.5M	1.5M	100.0%	14.8%	11.6M	11.1M	96.1%	8.7M	74.8%	2.5M	1.5M	9.7%	76.4%	39.0%	151bp	151bp	27%	15.2M	85.9%	1376.4Mb	13.6M	38.9%	89.4%	28.7%	141.0bp	86.7%	38.0%	118bp	141bp	18%	13.6M
UIfop7C5	0.79	1.0M	0.4M	0.2M	0.1M	0.1M	0.62%	0.6M	1.0M	100.0%	0.0%	5.1%	1.0M	0.0bp	1.6M	1.6M	100.0%	14.3%	11.1M	10.5M	95.1%	9.0M	81.3%	1.5M	1.6M	11.1%	73.4%	41.0%	151bp	151bp	27%	15.2M	86.0%	1295.0Mb	12.9M	39.2%	85.0%	33.4%	141.0bp	85.9%	39.0%	116bp	141bp	18%	12.9M
UIfop7C6	0.78	1.2M	0.5M	0.3M	0.1M	0.1M	0.62%	0.7M	1.2M	100.0%	0.0%	4.9%	1.2M	0.0bp	1.8M	1.8M	100.0%	13.9%	13.2M	12.6M	95.4%	9.9M	75.2%	2.7M	1.8M	10.6%	73.7%	40.0%	151bp	151bp	27%	17.9M	86.0%	1540.6Mb	15.3M	38.9%	85.4%	32.0%	141.0bp	85.9%	38.0%	117bp	141bp	18%	15.3M
UIfop8C1	0.90	1.2M	0.5M	0.3M	0.1M	0.1M	0.59%	0.7M	1.2M	100.0%	0.0%	4.3%	1.2M	0.0bp	1.9M	1.9M	100.0%	17.8%	10.8M	10.3M	95.9%	8.8M	81.8%	1.5M	1.9M	13.8%	72.6%	39.0%	151bp	151bp	27%	14.6M	85.8%	1292.2Mb	13.1M	39.0%	89.4%	32.0%	141.0bp	83.8%	39.0%	115bp	141bp	27%	13.1M
UIfop8C2	0.94	1.6M	0.7M	0.5M	0.2M	0.1M	0.57%	0.8M	1.6M	100.0%	0.0%	3.9%	1.6M	0.0bp	2.4M	2.4M	100.0%	16.4%	12.6M	12.2M	96.9%	10.4M	83.0%	1.8M	2.4M	14.8%	71.3%	40.0%	151bp	151bp	27%	16.7M	86.0%	1465.1Mb	15.1M	39.8%	90.2%	35.2%	141.0bp	83.1%	39.0%	113bp	141bp	27%	15.1M
UIfop8C3	0.89	1.2M	0.5M	0.3M	0.1M	0.1M	0.64%	0.7M	1.2M	100.0%	0.0%	5.1%	1.2M	0.0bp	1.9M	1.9M	100.0%	12.8%	15.8M	15.1M	95.8%	12.7M	80.2%	2.5M	1.9M	9.2%	75.3%	41.0%	151bp	151bp	27%	21.2M	85.9%	1754.0Mb	18.1M	39.8%	85.3%	38.4%	141.0bp	86.9%	39.0%	113bp	141bp	18%	18.1M
UIfop8C4	0.80	0.9M	0.4M	0.2M	0.1M	0.1M	0.62%	0.5M	0.9M	100.0%	0.0%	5.0%	0.9M	0.0bp	1.4M	1.4M	100.0%	16.4%	11.6M	11.1M	95.9%	9.5M	81.8%	1.6M	1.4M	9.4%	78.3%	38.0%	151bp	151bp	27%	15.6M	85.8%	1374.5Mb	13.8M	38.3%	88.8%	31.2%	141.0bp	87.8%	38.0%	116bp	141bp	18%	13.8M
UIfop8C5	0.83	0.9M	0.4M	0.2M	0.1M	0.1M	0.62%	0.5M	0.9M	100.0%	0.0%	4.6%	0.9M	0.0bp	1.5M	1.5M	100.0%	16.0%	16.6M	16.0M	96.4%	13.7M	82.8%	2.3M	1.5M	7.1%	80.8%	39.0%	151bp	151bp	27%	21.9M	85.9%	1987.2Mb	19.7M	38.6%	89.8%	28.5%	141.0bp	90.2%	38.0%	118bp	141bp	18%	19.7M
UIfop8C6	0.85	1.2M	0.5M	0.3M	0.1M	0.1M	0.63%	0.8M	1.2M	100.0%	0.0%	5.7%	1.2M	0.0bp	2.1M	2.1M	100.0%	13.1%	13.6M	12.6M	92.4%	10.4M	76.2%	2.2M	2.1M	11.6%	69.9%	43.0%	151bp	151bp	27%	21.1M	85.3%	1476.7Mb	15.7M	38.9%	74.1%	44.3%	141.0bp	83.7%	38.0%	111bp	137bp	18%	15.7M
UIprop7B2	0.80	1.2M	0.5M	0.3M	0.1M	0.1M	0.60%	0.7M	1.2M	100.0%	0.0%	4.7%	1.2M	0.0bp	1.8M	1.8M	100.0%	17.4%	12.0M	11.5M	96.2%	9.8M	82.0%	1.7M	1.8M	11.8%	75.6%	38.0%	151bp	151bp	27%	16.2M	85.7%	1410.1Mb	14.5M	38.5%	89.6%	33.4%	141.0bp	86.0%	38.0%	113bp	141bp	27%	14.5M
UIprop7B3	0.80	1.3M	0.5M	0.4M	0.1M	0.1M	0.62%	0.7M	1.3M	100.0%	0.0%	4.5%	1.3M	0.0bp	2.1M	2.1M	100.0%	13.2%	14.0M	13.5M	96.3%	10.9M	77.9%	2.6M	2.1M	10.9%	73.6%	40.0%	151bp	151bp	27%	18.3M	85.7%	1569.0Mb	16.1M	39.4%	87.9%	35.6%	141.0bp	85.1%	39.0%	114bp	141bp	18%	16.1M
UIprop7B4	0.73	1.5M	0.6M	0.4M	0.2M	0.1M	0.60%	0.8M	1.5M	100.0%	0.0%	4.2%	1.5M	0.0bp	2.3M	2.3M	100.0%	15.4%	16.3M	15.7M	96.6%	13.2M	81.3%	2.5M	2.3M	10.9%	77.3%	37.0%	151bp	151bp	27%	20.8M	85.9%	1921.0Mb	19.2M	38.0%	92.5%	29.5%	141.0bp	86.5%	38.0%	116bp	141bp	18%	19.2M
UIprop7B5	0.76	1.2M	0.5M	0.3M	0.1M	0.1M	0.61%	0.7M	1.2M	100.0%	0.0%	4.8%	1.2M	0.0bp	1.8M	1.8M	100.0%	15.6%	15.5M	14.9M	96.2%	12.9M	82.9%	2.1M	1.8M	9.3%	77.3%	40.0%	151bp	151bp	27%	20.7M	86.3%	1814.6Mb	18.4M	39.6%	88.9%	35.3%	141.0bp	87.8%	39.0%	114bp	141bp	27%	18.4M
UIprop7B6	0.70	0.9M	0.4M	0.3M	0.1M	0.1M	0.63%	0.6M	0.9M	100.0%	0.0%	4.9%	0.9M	0.0bp	1.5M	1.5M	100.0%	13.7%	12.6M	12.1M	96.0%	10.4M	82.6%	1.7M	1.5M	9.5%	76.4%	40.0%	151bp	151bp	27%	16.8M	86.3%	1472.9Mb	14.6M	39.2%	87.1%	30.8%	141.0bp	87.5%	39.0%	117bp	141bp	18%	14.6M
UIprop8B1	0.83	1.1M	0.5M	0.3M	0.1M	0.1M	0.60%	0.6M	1.1M	100.0%	0.0%	4.5%	1.1M	0.0bp	1.7M	1.7M	100.0%	17.4%	10.6M	10.2M	96.3%	8.7M	82.7%	1.4M	1.7M	12.3%	75.0%	40.0%	151bp	151bp	27%	14.2M	85.9%	1253.7Mb	12.8M	39.4%	90.0%	33.9%	141.0bp	85.4%	39.0%	114bp	141bp	27%	12.8M
UIprop8B2	0.95	1.5M	0.6M	0.5M	0.1M	0.1M	0.57%	0.7M	1.5M	100.0%	0.0%	3.5%	1.5M	0.0bp	2.2M	2.2M	100.0%	16.4%	10.5M	10.2M	97.1%	8.6M	81.5%	1.6M	2.2M	15.8%	71.8%	38.0%	151bp	151bp	27%	13.6M	86.1%	1263.1Mb	12.6M	38.8%	92.7%	29.3%	141.0bp	82.0%	38.0%	117bp	141bp	18%	12.6M
UIprop8B3	0.79	1.7M	0.7M	0.6M	0.2M	0.1M	0.59%	1.0M	1.7M	100.0%	0.0%	4.7%	1.7M	0.0bp	2.7M	2.7M	100.0%	13.4%	22.2M	21.4M	96.5%	18.3M	82.6%	3.1M	2.7M	9.3%	77.4%	40.0%	151bp	151bp	27%	29.1M	86.5%	2450.3Mb	25.7M	39.3%	88.1%	40.7%	141.0bp	87.6%	39.0%	110bp	141bp	18%	25.7M
UIprop8B4	0.69	1.3M	0.5M	0.4M	0.1M	0.1M	0.61%	0.8M	1.3M	100.0%	0.0%	4.7%	1.3M	0.0bp	2.0M	2.0M	100.0%	15.2%	18.7M	18.0M	96.2%	15.0M	80.2%	3.0M	2.0M	8.4%	79.3%	38.0%	151bp	151bp	27%	24.6M	86.0%	2202.6Mb	22.1M	38.1%	89.7%	30.8%	141.0bp	88.7%	38.0%	116bp	141bp	18%	22.1M
UIprop8B5	0.74	1.6M	0.7M	0.4M	0.2M	0.1M	0.58%	0.9M	1.6M	100.0%	0.0%	4.4%	1.6M	0.0bp	2.4M	2.4M	100.0%	13.4%	16.5M	15.9M	96.2%	13.7M	83.0%	2.2M	2.4M	11.6%	73.9%	39.0%	151bp	151bp	27%	21.6M	86.3%	1933.4Mb	19.1M	38.9%	88.2%	30.2%	141.0bp	85.6%	38.0%	118bp	141bp	18%	19.1M
UIprop8B6	0.74	1.1M	0.4M	0.3M	0.1M	0.1M	0.62%	0.8M	1.1M	100.0%	0.0%	5.8%	1.1M	0.0bp	1.9M	1.9M	100.0%	14.7%	15.0M	14.0M	93.8%	11.9M	79.8%	2.1M	1.9M	9.9%	74.2%	40.0%	151bp	151bp	27%	22.0M	85.9%	1742.9Mb	17.5M	38.4%	79.9%	35.4%	141.0bp	87.0%	38.0%	116bp	141bp	18%	17.5M
Uiprop7B1	0.81	1.1M	0.5M	0.3M	0.1M	0.1M	0.62%	0.7M	1.1M	100.0%	0.0%	4.7%	1.1M	0.0bp	1.8M	1.8M	100.0%	17.0%	10.1M	9.7M	95.5%	8.1M	80.5%	1.5M	1.8M	13.4%	71.4%	40.0%	151bp	151bp	27%	14.1M	85.8%	1185.4Mb	12.2M	39.2%	86.2%	35.8%	141.0bp	84.0%	39.0%	113bp	141bp	18%	12.2M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	QualiMap: RNASeq	5'-3' bias	5'-3' bias	`qualimap_rnaseq-5_3_bias`
\|\|	QualiMap: RNASeq	M Aligned	Reads Aligned (millions)	`qualimap_rnaseq-reads_aligned`	read_count
\|\|	QualiMap: RNASeq	Exonic	Reads aligned to exonic regions	`qualimap_rnaseq-reads_aligned_exonic`	read_count
\|\|	QualiMap: RNASeq	Intronic	Reads aligned to intronic regions	`qualimap_rnaseq-reads_aligned_intronic`	read_count
\|\|	QualiMap: RNASeq	Intergenic	Reads aligned to intergenic regions	`qualimap_rnaseq-reads_aligned_intergenic`	read_count
\|\|	QualiMap: RNASeq	Overlapping Exon	Reads aligned to overlapping exon regions	`qualimap_rnaseq-reads_aligned_overlapping_exon`	read_count
\|\|	Samtools: stats	Error rate	Error rate: mismatches (NM) / bases mapped (CIGAR)	`samtools_stats-error_rate`
\|\|	Samtools: stats	Non-primary	Non-primary alignments (millions)	`samtools_stats-non_primary_alignments`	read_count
\|\|	Samtools: stats	Reads mapped	Reads mapped in the bam file (millions)	`samtools_stats-reads_mapped`	read_count
\|\|	Samtools: stats	% Mapped	% Mapped reads	`samtools_stats-reads_mapped_percent`
\|\|	Samtools: stats	% Proper pairs	% Properly paired reads	`samtools_stats-reads_properly_paired_percent`
\|\|	Samtools: stats	% MapQ 0 reads	% of reads that are ambiguously placed (MapQ=0)	`samtools_stats-reads_MQ0_percent`
\|\|	Samtools: stats	Total seqs	Total sequences in the bam file (millions)	`samtools_stats-raw_total_sequences`	read_count
\|\|	Samtools: stats	Mean insert	Average insert size	`samtools_stats-insert_size_average`
\|\|	Samtools: flagstat	Reads	Total reads in the bam file (millions)	`samtools_flagstat-flagstat_total`	read_count
\|\|	Samtools: flagstat	Reads mapped	Reads mapped in the bam file (millions)	`samtools_flagstat-mapped_passed`	read_count
\|\|	Samtools: flagstat	% Reads mapped	% Reads mapped in the bam file	`samtools_flagstat-mapped_passed_pct`
\|\|	SortMeRNA	rRNA	Percentage of reads matched to a SortMeRNA database	`sortmerna-rRNA_pct`
\|\|	STAR	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	STAR	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	STAR	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	STAR	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	STAR	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	STAR	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	UMI-tools	M Unique Reads	Reads remaining after deduplication (millions)	`umi_tools-dedup_output_reads`	read_count
\|\|	UMI-tools	% Pass Dedup	% processed reads that passed deduplication	`umi_tools-dedup_percent_passing`
\|\|	FastQC (raw)	Dups	% duplicate reads	`fastqc_raw-percent_duplicates`
\|\|	FastQC (raw)	GC	Average % GC content	`fastqc_raw-percent_gc`
\|\|	FastQC (raw)	Avg len	Average read length	`fastqc_raw-avg_sequence_length`
\|\|	FastQC (raw)	Median len	Median read length	`fastqc_raw-median_sequence_length`
\|\|	FastQC (raw)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_raw-percent_fails`
\|\|	FastQC (raw)	Seqs	Total sequences (millions)	`fastqc_raw-total_sequences`	read_count
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`fastp-after_filtering_q30_rate`
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`fastp-after_filtering_q30_bases`	base_count
\|\|	fastp	Reads After Filtering	Total reads after filtering (millions)	`fastp-filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`fastp-after_filtering_gc_content`
\|\|	fastp	% PF	Percent reads passing filter	`fastp-pct_surviving`
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`fastp-pct_adapter`
\|\|	fastp	Mean R1 Length	Mean read length of R1	`fastp-before_filtering_read1_mean_length`
\|\|	FastQC (trimmed)	Dups	% duplicate reads	`fastqc_trimmed-percent_duplicates`
\|\|	FastQC (trimmed)	GC	Average % GC content	`fastqc_trimmed-percent_gc`
\|\|	FastQC (trimmed)	Avg len	Average read length	`fastqc_trimmed-avg_sequence_length`
\|\|	FastQC (trimmed)	Median len	Median read length	`fastqc_trimmed-median_sequence_length`
\|\|	FastQC (trimmed)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_trimmed-percent_fails`
\|\|	FastQC (trimmed)	Seqs	Total sequences (millions)	`fastqc_trimmed-total_sequences`	read_count

Sample status checks

Reports on sample strandedness status, and any failures in trimming or mapping.

Strandedness Checks

The strandedness used for analysis in this workflow can either be provided by the user or automatically inferred by Salmon using a sample of reads. In both cases, strandedness is verified at the end of the workflow using RSeQC's infer_experiment.py on genomic alignments. In this table, a pass indicates a match between the supplied strandedness (or that inferred by Salmon) and RSeQC results. A fail indicates a mismatch or 'undetermined' strandedness. 'Undetermined' strandedness can signal QC issues, including potential genomic DNA contamination.

Note: Rows are duplicated for an 'auto' setting to allow comparison of statistics between inference methods.

Showing ²⁰⁴/₂₀₄ rows and ⁷/₇ columns.

Sample	Status	Strand inference method	Provided strandedness	Inferred strandedness	Sense (%)	Antisense (%)	Unstranded (%)
UI014p1B1	pass	RSeQC	auto	forward	85.5	5.3	9.1
UI014p1B2	pass	RSeQC	auto	forward	85.6	5.8	8.7
UI014p1B3	pass	RSeQC	auto	forward	85.9	4.9	9.2
UI014p1B4	pass	RSeQC	auto	forward	85.8	5.1	9.1
UI014p1B5	pass	RSeQC	auto	forward	85.9	5.5	8.6
UI014p1B6	pass	RSeQC	auto	forward	85.6	4.9	9.5
UI014p2B1	pass	RSeQC	auto	forward	85.7	6.2	8.1
UI014p2B2	pass	RSeQC	auto	forward	86.0	4.6	9.4
UI014p2B3	pass	RSeQC	auto	forward	86.7	4.3	9.0
UI014p2B4	pass	RSeQC	auto	forward	86.3	4.3	9.4
UI014p2B5	pass	RSeQC	auto	forward	85.9	4.7	9.4
UI014p2B6	pass	RSeQC	auto	forward	86.6	4.2	9.2
UI015p1C1	pass	RSeQC	auto	forward	85.5	5.2	9.3
UI015p1C2	pass	RSeQC	auto	forward	85.1	5.6	9.3
UI015p1C3	pass	RSeQC	auto	forward	85.7	4.8	9.5
UI015p1C4	pass	RSeQC	auto	forward	85.7	4.6	9.7
UI015p1C5	pass	RSeQC	auto	forward	84.3	5.8	9.9
UI015p1C6	pass	RSeQC	auto	forward	85.8	4.7	9.5
UI015p2C1	pass	RSeQC	auto	forward	85.0	6.8	8.2
UI015p2C2	pass	RSeQC	auto	forward	85.6	5.4	9.0
UI015p2C3	pass	RSeQC	auto	forward	86.0	4.8	9.2
UI015p2C4	pass	RSeQC	auto	forward	85.9	4.9	9.1
UI015p2C5	pass	RSeQC	auto	forward	86.1	5.2	8.6
UI015p2C6	pass	RSeQC	auto	forward	84.8	7.5	7.8
UI016p1D1	pass	RSeQC	auto	forward	84.6	6.7	8.7
UI016p1D2	pass	RSeQC	auto	forward	85.0	6.3	8.7
UI016p1D3	pass	RSeQC	auto	forward	84.8	6.8	8.4
UI016p1D4	pass	RSeQC	auto	forward	85.1	5.8	9.1
UI016p1D5	pass	RSeQC	auto	forward	85.4	5.4	9.1
UI016p1D6	pass	RSeQC	auto	forward	86.1	4.7	9.2
UI016p2A1	pass	RSeQC	auto	forward	85.1	6.4	8.5
UI016p2A2	pass	RSeQC	auto	forward	85.4	6.0	8.7
UI016p2A3	pass	RSeQC	auto	forward	85.8	5.2	9.1
UI016p2A4	pass	RSeQC	auto	forward	85.9	4.7	9.4
UI016p2A5	pass	RSeQC	auto	forward	85.5	5.0	9.5
UI016p2A6	pass	RSeQC	auto	forward	84.8	6.7	8.5
UI017p3B1	pass	RSeQC	auto	forward	86.3	3.8	9.8
UI017p3B2	pass	RSeQC	auto	forward	86.5	4.1	9.5
UI017p3B3	pass	RSeQC	auto	forward	86.1	5.3	8.6
UI017p3B4	pass	RSeQC	auto	forward	86.3	4.9	8.8
UI017p3B5	pass	RSeQC	auto	forward	84.0	6.0	10.0
UI017p3B6	pass	RSeQC	auto	forward	85.7	4.7	9.5
UI017p4B1	pass	RSeQC	auto	forward	86.9	4.3	8.8
UI017p4B2	pass	RSeQC	auto	forward	86.3	4.4	9.3
UI017p4B3	pass	RSeQC	auto	forward	86.2	4.5	9.3
UI017p4B4	pass	RSeQC	auto	forward	85.1	5.2	9.7
UI017p4B5	pass	RSeQC	auto	forward	86.0	4.0	10.0
UI017p4B6	pass	RSeQC	auto	forward	85.9	4.2	9.9
UI018p3C1	pass	RSeQC	auto	forward	85.7	4.9	9.3
UI018p3C2	pass	RSeQC	auto	forward	86.6	3.8	9.6
UI018p3C3	pass	RSeQC	auto	forward	86.1	5.2	8.7
UI018p3C4	pass	RSeQC	auto	forward	86.1	4.2	9.6
UI018p3C5	pass	RSeQC	auto	forward	85.7	5.6	8.7
UI018p3C6	pass	RSeQC	auto	forward	85.9	4.3	9.8
UI018p4C1	pass	RSeQC	auto	forward	86.7	4.5	8.8
UI018p4C2	pass	RSeQC	auto	forward	87.0	4.2	8.9
UI018p4C3	pass	RSeQC	auto	forward	85.8	4.3	9.9
UI018p4C4	pass	RSeQC	auto	forward	85.9	5.3	8.8
UI018p4C5	pass	RSeQC	auto	forward	86.2	4.7	9.1
UI018p4C6	pass	RSeQC	auto	forward	85.0	6.4	8.7
UI019p3D1	pass	RSeQC	auto	forward	84.8	6.3	8.9
UI019p3D2	pass	RSeQC	auto	forward	85.8	5.6	8.6
UI019p3D3	pass	RSeQC	auto	forward	86.0	5.6	8.5
UI019p3D4	pass	RSeQC	auto	forward	83.4	6.7	10.0
UI019p3D5	pass	RSeQC	auto	forward	82.8	7.5	9.8
UI019p3D6	pass	RSeQC	auto	forward	85.0	5.6	9.4
UI019p4A1	pass	RSeQC	auto	forward	81.1	9.4	9.5
UI019p4A2	pass	RSeQC	auto	forward	81.4	8.9	9.6
UI019p4A3	pass	RSeQC	auto	forward	82.7	7.3	10.0
UI019p4A4	pass	RSeQC	auto	forward	85.5	5.8	8.7
UI019p4A5	pass	RSeQC	auto	forward	85.2	5.9	8.9
UI019p4A6	pass	RSeQC	auto	forward	83.6	7.5	8.9
UI074p5B1	pass	RSeQC	auto	forward	85.2	5.6	9.3
UI074p5B2	pass	RSeQC	auto	forward	85.2	5.4	9.4
UI074p5B3	pass	RSeQC	auto	forward	87.1	4.4	8.5
UI074p5B4	pass	RSeQC	auto	forward	86.0	4.6	9.4
UI074p5B5	pass	RSeQC	auto	forward	85.3	5.7	9.0
UI074p5B6	pass	RSeQC	auto	forward	85.7	5.5	8.7
UI074p6B1	pass	RSeQC	auto	forward	85.0	5.3	9.7
UI074p6B2	pass	RSeQC	auto	forward	87.5	4.1	8.4
UI074p6B3	pass	RSeQC	auto	forward	89.1	3.7	7.3
UI074p6B4	pass	RSeQC	auto	forward	88.7	3.9	7.5
UI074p6B5	pass	RSeQC	auto	forward	87.3	3.9	8.8
UI074p6B6	pass	RSeQC	auto	forward	87.6	3.7	8.7
UI075p5C1	pass	RSeQC	auto	forward	85.5	5.3	9.2
UI075p5C2	pass	RSeQC	auto	forward	85.5	5.0	9.4
UI075p5C3	pass	RSeQC	auto	forward	85.2	5.6	9.3
UI075p5C4	pass	RSeQC	auto	forward	87.6	4.1	8.3
UI075p5C5	pass	RSeQC	auto	forward	85.2	5.8	9.0
UI075p5C6	pass	RSeQC	auto	forward	85.7	4.9	9.4
UI075p6C1	pass	RSeQC	auto	forward	86.1	4.9	9.0
UI075p6C2	pass	RSeQC	auto	forward	86.8	4.7	8.5
UI075p6C3	pass	RSeQC	auto	forward	87.7	4.1	8.3
UI075p6C4	pass	RSeQC	auto	forward	89.0	3.6	7.4
UI075p6C5	pass	RSeQC	auto	forward	87.7	3.5	8.8
UI075p6C6	pass	RSeQC	auto	forward	85.9	4.5	9.6
UI076p10B1	pass	RSeQC	auto	forward	85.7	5.1	9.2
UI076p10B2	pass	RSeQC	auto	forward	86.1	4.3	9.5
UI076p10B3	pass	RSeQC	auto	forward	87.7	3.6	8.7
UI076p10B4	pass	RSeQC	auto	forward	88.2	3.6	8.3
UI076p10B5	pass	RSeQC	auto	forward	87.9	3.7	8.4
UI076p10B6	pass	RSeQC	auto	forward	87.2	3.7	9.0
UI076p10C1	pass	RSeQC	auto	forward	85.5	5.0	9.5
UI076p10C2	pass	RSeQC	auto	forward	86.1	4.8	9.1
UI076p10C3	pass	RSeQC	auto	forward	87.7	3.6	8.7
UI076p10C4	pass	RSeQC	auto	forward	88.0	3.4	8.6
UI076p10C5	pass	RSeQC	auto	forward	86.2	4.3	9.5
UI076p10C6	pass	RSeQC	auto	forward	86.4	4.2	9.4
UIDMSOp1A1	pass	RSeQC	auto	forward	85.9	5.2	9.0
UIDMSOp1A2	pass	RSeQC	auto	forward	85.9	5.7	8.3
UIDMSOp1A3	pass	RSeQC	auto	forward	85.7	5.4	8.9
UIDMSOp1A4	pass	RSeQC	auto	forward	85.9	4.9	9.1
UIDMSOp1A5	pass	RSeQC	auto	forward	85.9	4.7	9.4
UIDMSOp1A6	pass	RSeQC	auto	forward	86.6	4.9	8.5
UIDMSOp2A1	pass	RSeQC	auto	forward	85.3	6.4	8.3
UIDMSOp2A2	pass	RSeQC	auto	forward	86.6	4.5	8.9
UIDMSOp2A3	pass	RSeQC	auto	forward	85.8	5.0	9.2
UIDMSOp2A4	pass	RSeQC	auto	forward	87.4	3.8	8.8
UIDMSOp2A5	pass	RSeQC	auto	forward	86.6	4.3	9.1
UIDMSOp2A6	pass	RSeQC	auto	forward	86.2	5.2	8.7
UIDMSOp3A1	pass	RSeQC	auto	forward	85.9	4.4	9.7
UIDMSOp3A2	pass	RSeQC	auto	forward	86.2	4.2	9.5
UIDMSOp3A3	pass	RSeQC	auto	forward	86.1	5.2	8.7
UIDMSOp3A4	pass	RSeQC	auto	forward	87.0	4.1	8.9
UIDMSOp3A5	pass	RSeQC	auto	forward	86.2	4.7	9.1
UIDMSOp3A6	pass	RSeQC	auto	forward	85.6	4.8	9.7
UIDMSOp4A1	pass	RSeQC	auto	forward	86.0	4.7	9.3
UIDMSOp4A2	pass	RSeQC	auto	forward	85.7	4.3	10.1
UIDMSOp4A3	pass	RSeQC	auto	forward	86.1	4.4	9.5
UIDMSOp4A4	pass	RSeQC	auto	forward	86.1	4.2	9.7
UIDMSOp4A5	pass	RSeQC	auto	forward	85.3	4.9	9.8
UIDMSOp4A6	pass	RSeQC	auto	forward	84.4	6.6	9.0
UIDMSOp5A1	pass	RSeQC	auto	forward	83.5	8.5	7.9
UIDMSOp5A2	pass	RSeQC	auto	forward	85.3	5.1	9.5
UIDMSOp5A3	pass	RSeQC	auto	forward	86.5	4.8	8.7
UIDMSOp5A4	pass	RSeQC	auto	forward	87.7	4.0	8.3
UIDMSOp5A5	pass	RSeQC	auto	forward	85.2	5.9	9.0
UIDMSOp5A6	pass	RSeQC	auto	forward	85.3	6.1	8.7
UIDMSOp6A1	pass	RSeQC	auto	forward	86.4	4.9	8.7
UIDMSOp6A2	pass	RSeQC	auto	forward	87.8	4.2	8.0
UIDMSOp6A3	pass	RSeQC	auto	forward	86.2	5.1	8.7
UIDMSOp6A4	pass	RSeQC	auto	forward	88.7	4.1	7.2
UIDMSOp6A5	pass	RSeQC	auto	forward	85.3	5.1	9.5
UIDMSOp6A6	pass	RSeQC	auto	forward	88.1	4.3	7.6
UIDMSOp7A1	pass	RSeQC	auto	forward	86.4	3.8	9.8
UIDMSOp7A2	pass	RSeQC	auto	forward	86.3	3.8	9.9
UIDMSOp7A3	pass	RSeQC	auto	forward	86.0	4.2	9.8
UIDMSOp7A4	pass	RSeQC	auto	forward	86.7	3.5	9.8
UIDMSOp7A5	pass	RSeQC	auto	forward	85.7	4.8	9.6
UIDMSOp7A6	pass	RSeQC	auto	forward	88.0	3.2	8.8
UIDMSOp8A1	pass	RSeQC	auto	forward	86.4	4.0	9.5
UIDMSOp8A2	pass	RSeQC	auto	forward	87.7	3.2	9.1
UIDMSOp8A3	pass	RSeQC	auto	forward	86.7	3.8	9.5
UIDMSOp8A4	pass	RSeQC	auto	forward	85.9	4.2	10.0
UIDMSOp8A5	pass	RSeQC	auto	forward	86.5	3.9	9.6
UIDMSOp8A6	pass	RSeQC	auto	forward	85.7	4.1	10.1
UIDMSOp10A1	pass	RSeQC	auto	forward	87.5	3.9	8.6
UIDMSOp10A2	pass	RSeQC	auto	forward	87.4	3.9	8.7
UIDMSOp10A3	pass	RSeQC	auto	forward	88.7	3.8	7.5
UIDMSOp10A4	pass	RSeQC	auto	forward	89.2	3.4	7.4
UIDMSOp10A5	pass	RSeQC	auto	forward	88.9	3.7	7.4
UIDMSOp10A6	pass	RSeQC	auto	forward	89.1	3.5	7.4
UIDMSOp11A1	pass	RSeQC	auto	forward	89.2	4.1	6.7
UIDMSOp11A2	pass	RSeQC	auto	forward	89.4	3.8	6.8
UIDMSOp11A3	pass	RSeQC	auto	forward	90.2	3.6	6.2
UIDMSOp11A4	pass	RSeQC	auto	forward	90.6	3.5	6.0
UIDMSOp11A5	pass	RSeQC	auto	forward	90.3	3.5	6.2
UIDMSOp11A6	pass	RSeQC	auto	forward	90.6	3.1	6.4
UIMCHp11B1	pass	RSeQC	auto	forward	90.4	3.4	6.2
UIMCHp11B2	pass	RSeQC	auto	forward	90.1	3.6	6.3
UIMCHp11B3	pass	RSeQC	auto	forward	89.3	3.8	6.9
UIMCHp11B4	pass	RSeQC	auto	forward	89.3	3.9	6.8
UIMCHp11B5	pass	RSeQC	auto	forward	89.1	3.7	7.3
UIMCHp11B6	pass	RSeQC	auto	forward	89.2	3.6	7.2
UIMCHp11C1	pass	RSeQC	auto	forward	89.6	3.7	6.7
UIMCHp11C2	pass	RSeQC	auto	forward	90.5	3.6	6.0
UIMCHp11C3	pass	RSeQC	auto	forward	89.0	3.8	7.2
UIMCHp11C4	pass	RSeQC	auto	forward	90.5	3.2	6.3
UIMCHp11C5	pass	RSeQC	auto	forward	90.5	3.4	6.1
UIMCHp11C6	pass	RSeQC	auto	forward	90.3	3.1	6.6
UIfop7C1	pass	RSeQC	auto	forward	86.0	4.2	9.7
UIfop7C2	pass	RSeQC	auto	forward	86.1	3.9	10.0
UIfop7C3	pass	RSeQC	auto	forward	86.1	4.6	9.3
UIfop7C4	pass	RSeQC	auto	forward	86.2	4.0	9.8
UIfop7C5	pass	RSeQC	auto	forward	85.7	4.6	9.7
UIfop7C6	pass	RSeQC	auto	forward	86.0	4.3	9.8
UIfop8C1	pass	RSeQC	auto	forward	86.0	4.1	9.8
UIfop8C2	pass	RSeQC	auto	forward	87.3	3.5	9.2
UIfop8C3	pass	RSeQC	auto	forward	85.5	4.8	9.7
UIfop8C4	pass	RSeQC	auto	forward	86.3	4.3	9.4
UIfop8C5	pass	RSeQC	auto	forward	86.1	4.1	9.8
UIfop8C6	pass	RSeQC	auto	forward	85.5	4.8	9.7
UIprop7B2	pass	RSeQC	auto	forward	85.9	4.4	9.7
UIprop7B3	pass	RSeQC	auto	forward	86.0	4.1	9.9
UIprop7B4	pass	RSeQC	auto	forward	86.8	3.7	9.5
UIprop7B5	pass	RSeQC	auto	forward	85.8	4.4	9.7
UIprop7B6	pass	RSeQC	auto	forward	86.0	4.7	9.4
UIprop8B1	pass	RSeQC	auto	forward	86.4	4.1	9.4
UIprop8B2	pass	RSeQC	auto	forward	87.7	2.9	9.4
UIprop8B3	pass	RSeQC	auto	forward	87.7	3.6	8.7
UIprop8B4	pass	RSeQC	auto	forward	85.6	4.3	10.1
UIprop8B5	pass	RSeQC	auto	forward	87.4	3.2	9.4
UIprop8B6	pass	RSeQC	auto	forward	85.5	4.9	9.6
Uiprop7B1	pass	RSeQC	auto	forward	86.1	4.3	9.6

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fail_strand_check_table_table

Sort	Column	Description	ID
\|\|	Status	Pass if the strandedness inferred by RSeQC matches that provided by the user or predicted by Salmon. Fail otherwise.	`samples_strandedness_check-Status`
\|\|	Strand inference method	Tool used to detect strandedness	`samples_strandedness_check-Strand_inference_method`
\|\|	Provided strandedness	User-provided strandedness	`samples_strandedness_check-Provided_strandedness`
\|\|	Inferred strandedness	Interred strandedness	`samples_strandedness_check-Inferred_strandedness`
\|\|	Sense (%)	Sense (%)	`samples_strandedness_check-Sense`
\|\|	Antisense (%)	Antisense (%)	`samples_strandedness_check-Antisense`
\|\|	Unstranded (%)	Unstranded (%)	`samples_strandedness_check-Unstranded`

FastQC (raw)

This section of the report shows FastQC results before adapter trimming.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

204

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

204

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

15

183

6

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

204

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

204

All samples have sequences of a single length (151bp)

Sequence Duplication Levels

10

194

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

204 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁵/₅ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
GGGGGGTGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	150	8313199	0.2192%
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTC	26	554241	0.0146%
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA	4	241409	0.0064%
AAAAAAAAAAAAAAAAAAAGATCGGAAGAGCACACGTCTGAACTCCAGTC	1	23891	0.0006%
CAAAAAAAAAAAAAAAAAAAGATCGGAAGAGCACACGTCTGAACTCCAGT	1	22893	0.0006%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_raw_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_raw-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_raw-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_raw-total_percent`

Adapter Content

204

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Created with MultiQC

fastp

All-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).https://github.com/OpenGene/fastpDOI: 10.1093/bioinformatics/bty560

Fastp goes through fastq files in a folder and perform a series of quality control and filtering. Quality control and reporting are displayed both before and after filtering, allowing for a clear depiction of the consequences of the filtering process. Notably, the latter can be conducted on a variety of parameters including quality scores, length, as well as the presence of adapters, polyG, or polyX tailing.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (trimmed)

This section of the report shows FastQC results after adapter trimming.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

204

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

204

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

61

120

23

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

204

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

204

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

204

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTC	204	10106187	0.3609%
GCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCA	204	8255228	0.2948%
GGCTGGTGTTAGGGTTCTTTGTTTTCGGGGTTTGGCAGAGATGTGTTTAA	160	5206533	0.1859%
CCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAG	180	4804416	0.1716%
ACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAA	201	4267020	0.1524%
TCGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGT	125	2807291	0.1002%
GCAAGGACTAACCCCTATACCTTCTGCATAATGAATTAACTAGAAATAAC	159	2730742	0.0975%
ACGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGT	122	2637636	0.0942%
AGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTC	135	2529473	0.0903%
GTACCGCAAGGGAAAGATGAAAAATTATAACCAAGCATAATATAGCAAGG	142	2518534	0.0899%
GGGTTCTTTGTTTTCGGGGTTTGGCAGAGATGTGTTTAAGTGCTGTGGCC	105	2438570	0.0871%
CTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATT	99	2040967	0.0729%
CCGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGT	86	1731833	0.0618%
GCGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGT	82	1545453	0.0552%
AAATTTGAAATCTGGTTAGGCTGGTGTTAGGGTTCTTTGTTTTCGGGGTT	71	1300249	0.0464%
GTGTTAGGGTTCTTTGTTTTCGGGGTTTGGCAGAGATGTGTTTAAGTGCT	54	985702	0.0352%
CTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACA	43	763052	0.0272%
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA	19	355988	0.0127%
GCTTTTCAGTCTCGACGGGCTAGCACACATCTGGTTGACTAGGCGCATAG	17	301022	0.0107%
TGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTC	19	270189	0.0096%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_trimmed_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_trimmed-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_trimmed-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_trimmed-total_percent`

Adapter Content

204

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Created with MultiQC

Preseq

Estimates library complexity, showing how many additional unique reads are sequenced for increasing total read count.http://smithlabresearch.org/software/preseqDOI: 10.1038/nmeth.2375

A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

QualiMap

Quality control of alignment data and its derivatives like feature counts.http://qualimap.bioinfo.cipf.esDOI: 10.1093/bioinformatics/btv566; 10.1093/bioinformatics/bts503

Genomic origin of reads

Classification of mapped reads as originating in exonic, intronic or intergenic regions. These can be displayed as either the number or percentage of mapped reads.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. This allows mapped reads to be grouped by whether they originate in an exonic region (for QualiMap, this may include 5′ and 3′ UTR regions as well as protein-coding exons), an intron, or an intergenic region (see the Qualimap 2 documentation).

The inferred genomic origins of RNA-seq reads are presented here as a bar graph showing either the number or percentage of mapped reads in each read dataset that have been assigned to each type of genomic region. This graph can be used to assess the proportion of useful reads in an RNA-seq experiment. That proportion can be reduced by the presence of intron sequences, especially if depletion of ribosomal RNA was used during sample preparation (Sims et al. 2014). It can also be reduced by off-target transcripts, which are detected in greater numbers at the sequencing depths needed to detect poorly-expressed transcripts (Tarazona et al. 2011).

Created with MultiQC

Gene Coverage Profile

Mean distribution of coverage depth across the length of all mapped transcripts.

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. QualiMap uses this information to calculate the depth of coverage along the length of each annotated transcript. For a set of reads mapped to a transcript, the depth of coverage at a given base position is the number of high-quality reads that map to the transcript at that position (Sims et al. 2014).

QualiMap calculates coverage depth at every base position of each annotated transcript. To enable meaningful comparison between transcripts, base positions are rescaled to relative positions expressed as percentage distance along each transcript (0%, 1%, …, 99%). For the set of transcripts with at least one mapped read, QualiMap plots the cumulative mapped-read depth (y-axis) at each relative transcript position (x-axis). This plot shows the gene coverage profile across all mapped transcripts for each read dataset. It provides a visual way to assess positional biases, such as an accumulation of mapped reads at the 3′ end of transcripts, which may indicate poor RNA quality in the original sample (Conesa et al. 2016).

The Normalised plot is calculated by MultiQC to enable comparison of samples with varying sequencing depth. The cumulative mapped-read depth at each position across the averaged transcript position are divided by the total for that sample across the entire averaged transcript.

Created with MultiQC

RSeQC

Evaluates high throughput RNA-seq data.http://rseqc.sourceforge.netDOI: 10.1093/bioinformatics/bts356

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ²⁰⁴/₂₀₄ rows and ¹⁰/₁₀ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	+ve strand	-ve strand	Non-splice reads	Splice reads
UI014p1B1	1.7M	0.0M	0.0M	0.7M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI014p1B2	1.5M	0.0M	0.0M	0.7M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI014p1B3	1.6M	0.0M	0.0M	0.7M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI014p1B4	1.6M	0.0M	0.0M	0.7M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UI014p1B5	1.4M	0.0M	0.0M	0.6M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI014p1B6	1.9M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI014p2B1	1.4M	0.0M	0.0M	0.6M	0.0M	0.5M	0.3M	0.2M	0.5M	0.1M
UI014p2B2	2.0M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UI014p2B3	2.3M	0.0M	0.0M	0.9M	0.0M	1.2M	0.6M	0.5M	1.1M	0.1M
UI014p2B4	2.2M	0.0M	0.0M	0.8M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI014p2B5	1.9M	0.0M	0.0M	0.7M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UI014p2B6	2.4M	0.0M	0.0M	0.9M	0.0M	1.2M	0.7M	0.5M	1.1M	0.1M
UI015p1C1	1.7M	0.0M	0.0M	0.7M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI015p1C2	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI015p1C3	1.9M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI015p1C4	1.9M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI015p1C5	1.0M	0.0M	0.0M	0.5M	0.0M	0.4M	0.2M	0.2M	0.4M	0.0M
UI015p1C6	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI015p2C1	1.4M	0.0M	0.0M	0.7M	0.0M	0.5M	0.3M	0.2M	0.4M	0.0M
UI015p2C2	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
UI015p2C3	1.8M	0.0M	0.0M	0.7M	0.0M	0.8M	0.5M	0.4M	0.8M	0.1M
UI015p2C4	1.9M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.9M	0.1M
UI015p2C5	1.3M	0.0M	0.0M	0.5M	0.0M	0.6M	0.4M	0.3M	0.6M	0.1M
UI015p2C6	1.7M	0.0M	0.0M	0.9M	0.0M	0.6M	0.3M	0.3M	0.5M	0.0M
UI016p1D1	1.8M	0.0M	0.0M	0.9M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UI016p1D2	1.6M	0.0M	0.0M	0.8M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UI016p1D3	1.4M	0.0M	0.0M	0.7M	0.0M	0.5M	0.3M	0.2M	0.5M	0.1M
UI016p1D4	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI016p1D5	1.7M	0.0M	0.0M	0.7M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI016p1D6	1.7M	0.0M	0.0M	0.7M	0.0M	0.8M	0.5M	0.4M	0.7M	0.1M
UI016p2A1	1.6M	0.0M	0.0M	0.7M	0.0M	0.6M	0.4M	0.3M	0.6M	0.1M
UI016p2A2	1.6M	0.0M	0.0M	0.7M	0.0M	0.6M	0.4M	0.3M	0.6M	0.1M
UI016p2A3	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI016p2A4	2.3M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI016p2A5	2.1M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UI016p2A6	1.9M	0.0M	0.0M	0.9M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI017p3B1	0.7M	0.0M	0.0M	0.3M	0.0M	0.4M	0.2M	0.2M	0.3M	0.0M
UI017p3B2	1.6M	0.0M	0.0M	0.6M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI017p3B3	1.2M	0.0M	0.0M	0.5M	0.0M	0.6M	0.3M	0.2M	0.5M	0.1M
UI017p3B4	1.2M	0.0M	0.0M	0.5M	0.0M	0.5M	0.3M	0.2M	0.5M	0.1M
UI017p3B5	1.1M	0.0M	0.0M	0.5M	0.0M	0.4M	0.2M	0.2M	0.4M	0.0M
UI017p3B6	1.7M	0.0M	0.0M	0.7M	0.0M	0.8M	0.5M	0.4M	0.7M	0.1M
UI017p4B1	1.1M	0.0M	0.0M	0.4M	0.0M	0.5M	0.3M	0.2M	0.5M	0.1M
UI017p4B2	1.5M	0.0M	0.0M	0.6M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UI017p4B3	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI017p4B4	0.8M	0.0M	0.0M	0.4M	0.0M	0.3M	0.2M	0.1M	0.3M	0.0M
UI017p4B5	0.8M	0.0M	0.0M	0.3M	0.0M	0.4M	0.2M	0.2M	0.3M	0.0M
UI017p4B6	1.7M	0.0M	0.0M	0.6M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI018p3C1	0.7M	0.0M	0.0M	0.3M	0.0M	0.3M	0.2M	0.1M	0.2M	0.0M
UI018p3C2	1.4M	0.0M	0.0M	0.5M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UI018p3C3	1.3M	0.0M	0.0M	0.6M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI018p3C4	1.6M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
UI018p3C5	1.2M	0.0M	0.0M	0.5M	0.0M	0.5M	0.3M	0.2M	0.4M	0.1M
UI018p3C6	1.5M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UI018p4C1	1.3M	0.0M	0.0M	0.5M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI018p4C2	1.1M	0.0M	0.0M	0.4M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI018p4C3	1.9M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI018p4C4	1.1M	0.0M	0.0M	0.5M	0.0M	0.5M	0.3M	0.2M	0.4M	0.1M
UI018p4C5	1.2M	0.0M	0.0M	0.5M	0.0M	0.5M	0.3M	0.2M	0.5M	0.1M
UI018p4C6	1.8M	0.0M	0.0M	0.9M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UI019p3D1	1.8M	0.0M	0.0M	0.8M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UI019p3D2	1.1M	0.0M	0.0M	0.5M	0.0M	0.5M	0.3M	0.2M	0.4M	0.0M
UI019p3D3	1.0M	0.0M	0.0M	0.4M	0.0M	0.5M	0.3M	0.2M	0.4M	0.0M
UI019p3D4	1.2M	0.0M	0.0M	0.6M	0.0M	0.4M	0.2M	0.2M	0.4M	0.0M
UI019p3D5	1.2M	0.0M	0.0M	0.6M	0.0M	0.4M	0.2M	0.2M	0.4M	0.0M
UI019p3D6	1.7M	0.0M	0.0M	0.7M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UI019p4A1	1.0M	0.0M	0.0M	0.5M	0.0M	0.3M	0.2M	0.1M	0.3M	0.0M
UI019p4A2	1.0M	0.0M	0.0M	0.5M	0.0M	0.3M	0.2M	0.1M	0.3M	0.0M
UI019p4A3	1.1M	0.0M	0.0M	0.5M	0.0M	0.4M	0.2M	0.2M	0.4M	0.0M
UI019p4A4	1.1M	0.0M	0.0M	0.5M	0.0M	0.5M	0.3M	0.2M	0.4M	0.0M
UI019p4A5	1.3M	0.0M	0.0M	0.5M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI019p4A6	1.5M	0.0M	0.0M	0.8M	0.0M	0.5M	0.3M	0.2M	0.5M	0.1M
UI074p5B1	2.1M	0.0M	0.0M	0.9M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI074p5B2	2.1M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
UI074p5B3	2.6M	0.0M	0.0M	1.0M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UI074p5B4	2.2M	0.0M	0.0M	0.8M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI074p5B5	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
UI074p5B6	1.3M	0.0M	0.0M	0.5M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
UI074p6B1	2.2M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI074p6B2	2.6M	0.0M	0.0M	1.0M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UI074p6B3	3.4M	0.0M	0.0M	1.2M	0.0M	1.8M	1.0M	0.9M	1.7M	0.2M
UI074p6B4	3.0M	0.0M	0.0M	1.1M	0.0M	1.6M	0.8M	0.7M	1.4M	0.2M
UI074p6B5	2.8M	0.0M	0.0M	1.0M	0.0M	1.4M	0.8M	0.6M	1.3M	0.2M
UI074p6B6	2.6M	0.0M	0.0M	0.9M	0.0M	1.4M	0.8M	0.6M	1.3M	0.2M
UI075p5C1	2.1M	0.0M	0.0M	0.9M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UI075p5C2	2.0M	0.0M	0.0M	0.8M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI075p5C3	2.3M	0.0M	0.0M	1.0M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
UI075p5C4	2.8M	0.0M	0.0M	1.1M	0.0M	1.4M	0.8M	0.7M	1.3M	0.2M
UI075p5C5	1.7M	0.0M	0.0M	0.7M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UI075p5C6	1.5M	0.0M	0.0M	0.6M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UI075p6C1	2.3M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI075p6C2	2.4M	0.0M	0.0M	0.9M	0.0M	1.2M	0.6M	0.5M	1.1M	0.1M
UI075p6C3	2.6M	0.0M	0.0M	1.0M	0.0M	1.3M	0.7M	0.6M	1.1M	0.1M
UI075p6C4	2.9M	0.0M	0.0M	1.0M	0.0M	1.5M	0.8M	0.7M	1.4M	0.2M
UI075p6C5	2.3M	0.0M	0.0M	0.8M	0.0M	1.3M	0.7M	0.6M	1.1M	0.1M
UI075p6C6	2.1M	0.0M	0.0M	0.8M	0.0M	1.1M	0.6M	0.5M	0.9M	0.1M
UI076p10B1	2.3M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI076p10B2	2.1M	0.0M	0.0M	0.8M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UI076p10B3	2.5M	0.0M	0.0M	0.9M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UI076p10B4	2.6M	0.0M	0.0M	0.9M	0.0M	1.4M	0.8M	0.6M	1.3M	0.1M
UI076p10B5	2.7M	0.0M	0.0M	1.0M	0.0M	1.4M	0.8M	0.6M	1.3M	0.1M
UI076p10B6	2.4M	0.0M	0.0M	0.9M	0.0M	1.3M	0.7M	0.6M	1.1M	0.1M
UI076p10C1	2.0M	0.0M	0.0M	0.8M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UI076p10C2	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.5M	0.4M	0.7M	0.1M
UI076p10C3	2.5M	0.0M	0.0M	0.9M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UI076p10C4	2.5M	0.0M	0.0M	0.9M	0.0M	1.4M	0.8M	0.6M	1.2M	0.1M
UI076p10C5	2.0M	0.0M	0.0M	0.7M	0.0M	1.0M	0.6M	0.5M	0.9M	0.1M
UI076p10C6	1.9M	0.0M	0.0M	0.7M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UIDMSOp1A1	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.5M	0.4M	0.7M	0.1M
UIDMSOp1A2	1.5M	0.0M	0.0M	0.7M	0.0M	0.6M	0.4M	0.3M	0.6M	0.1M
UIDMSOp1A3	1.7M	0.0M	0.0M	0.7M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UIDMSOp1A4	1.8M	0.0M	0.0M	0.8M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
UIDMSOp1A5	1.9M	0.0M	0.0M	0.7M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UIDMSOp1A6	2.9M	0.0M	0.0M	1.2M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UIDMSOp2A1	1.6M	0.0M	0.0M	0.8M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
UIDMSOp2A2	2.4M	0.0M	0.0M	0.9M	0.0M	1.2M	0.6M	0.5M	1.1M	0.1M
UIDMSOp2A3	2.1M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UIDMSOp2A4	2.6M	0.0M	0.0M	1.0M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UIDMSOp2A5	2.2M	0.0M	0.0M	0.8M	0.0M	1.2M	0.7M	0.5M	1.1M	0.1M
UIDMSOp2A6	2.4M	0.0M	0.0M	1.0M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp3A1	1.8M	0.0M	0.0M	0.6M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIDMSOp3A2	1.5M	0.0M	0.0M	0.5M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIDMSOp3A3	1.4M	0.0M	0.0M	0.6M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UIDMSOp3A4	0.9M	0.0M	0.0M	0.4M	0.0M	0.5M	0.3M	0.2M	0.4M	0.1M
UIDMSOp3A5	1.4M	0.0M	0.0M	0.5M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UIDMSOp3A6	1.6M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIDMSOp4A1	1.6M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
UIDMSOp4A2	2.0M	0.0M	0.0M	0.7M	0.0M	1.0M	0.6M	0.5M	0.9M	0.1M
UIDMSOp4A3	1.7M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIDMSOp4A4	1.6M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
UIDMSOp4A5	2.1M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UIDMSOp4A6	1.9M	0.0M	0.0M	0.9M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIDMSOp5A1	1.7M	0.0M	0.0M	0.9M	0.0M	0.5M	0.3M	0.2M	0.5M	0.0M
UIDMSOp5A2	2.2M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp5A3	2.3M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp5A4	2.5M	0.0M	0.0M	0.9M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UIDMSOp5A5	1.6M	0.0M	0.0M	0.7M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UIDMSOp5A6	1.6M	0.0M	0.0M	0.7M	0.0M	0.7M	0.4M	0.3M	0.7M	0.1M
UIDMSOp6A1	2.3M	0.0M	0.0M	0.9M	0.0M	1.2M	0.6M	0.5M	1.1M	0.1M
UIDMSOp6A2	2.8M	0.0M	0.0M	1.1M	0.0M	1.4M	0.8M	0.6M	1.3M	0.1M
UIDMSOp6A3	2.3M	0.0M	0.0M	0.9M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp6A4	2.9M	0.0M	0.0M	1.0M	0.0M	1.5M	0.8M	0.7M	1.3M	0.2M
UIDMSOp6A5	2.1M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
UIDMSOp6A6	3.2M	0.0M	0.0M	1.2M	0.0M	1.6M	0.9M	0.7M	1.4M	0.2M
UIDMSOp7A1	1.9M	0.0M	0.0M	0.7M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp7A2	2.0M	0.0M	0.0M	0.7M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp7A3	2.0M	0.0M	0.0M	0.7M	0.0M	1.0M	0.6M	0.5M	0.9M	0.1M
UIDMSOp7A4	2.2M	0.0M	0.0M	0.7M	0.0M	1.2M	0.7M	0.5M	1.1M	0.1M
UIDMSOp7A5	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIDMSOp7A6	2.6M	0.0M	0.0M	0.9M	0.0M	1.5M	0.8M	0.6M	1.3M	0.2M
UIDMSOp8A1	2.1M	0.0M	0.0M	0.7M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp8A2	2.5M	0.0M	0.0M	0.9M	0.0M	1.4M	0.7M	0.6M	1.2M	0.1M
UIDMSOp8A3	1.4M	0.0M	0.0M	0.5M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIDMSOp8A4	1.8M	0.0M	0.0M	0.6M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIDMSOp8A5	2.2M	0.0M	0.0M	0.8M	0.0M	1.2M	0.6M	0.5M	1.0M	0.1M
UIDMSOp8A6	2.0M	0.0M	0.0M	0.7M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIDMSOp10A1	2.5M	0.0M	0.0M	0.9M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UIDMSOp10A2	2.6M	0.0M	0.0M	1.0M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UIDMSOp10A3	3.0M	0.0M	0.0M	1.1M	0.0M	1.5M	0.8M	0.7M	1.4M	0.1M
UIDMSOp10A4	3.5M	0.0M	0.0M	1.3M	0.0M	1.9M	1.0M	0.8M	1.7M	0.2M
UIDMSOp10A5	2.8M	0.0M	0.0M	1.0M	0.0M	1.5M	0.8M	0.7M	1.4M	0.2M
UIDMSOp10A6	2.9M	0.0M	0.0M	0.9M	0.0M	1.6M	0.9M	0.7M	1.4M	0.2M
UIDMSOp11A1	4.1M	0.0M	0.0M	1.4M	0.0M	2.3M	1.2M	1.1M	2.1M	0.2M
UIDMSOp11A2	3.7M	0.0M	0.0M	1.2M	0.0M	2.2M	1.1M	1.0M	2.0M	0.2M
UIDMSOp11A3	4.4M	0.0M	0.0M	1.4M	0.0M	2.5M	1.3M	1.2M	2.3M	0.2M
UIDMSOp11A4	4.4M	0.0M	0.0M	1.4M	0.0M	2.6M	1.4M	1.2M	2.4M	0.2M
UIDMSOp11A5	4.3M	0.0M	0.0M	1.4M	0.0M	2.4M	1.3M	1.1M	2.2M	0.2M
UIDMSOp11A6	4.5M	0.0M	0.0M	1.3M	0.0M	2.7M	1.4M	1.3M	2.5M	0.3M
UIMCHp11B1	4.9M	0.0M	0.0M	1.5M	0.0M	2.8M	1.5M	1.3M	2.6M	0.2M
UIMCHp11B2	4.4M	0.0M	0.0M	1.5M	0.0M	2.5M	1.3M	1.2M	2.3M	0.2M
UIMCHp11B3	4.0M	0.0M	0.0M	1.3M	0.0M	2.2M	1.2M	1.0M	2.0M	0.2M
UIMCHp11B4	4.1M	0.0M	0.0M	1.4M	0.0M	2.3M	1.2M	1.1M	2.1M	0.2M
UIMCHp11B5	3.5M	0.0M	0.0M	1.1M	0.0M	2.0M	1.1M	0.9M	1.8M	0.2M
UIMCHp11B6	3.7M	0.0M	0.0M	1.1M	0.0M	2.2M	1.2M	1.0M	2.0M	0.2M
UIMCHp11C1	5.5M	0.0M	0.0M	1.9M	0.0M	3.0M	1.6M	1.4M	2.8M	0.2M
UIMCHp11C2	4.3M	0.0M	0.0M	1.4M	0.0M	2.4M	1.3M	1.1M	2.2M	0.2M
UIMCHp11C3	3.7M	0.0M	0.0M	1.2M	0.0M	2.1M	1.1M	1.0M	1.9M	0.2M
UIMCHp11C4	4.7M	0.0M	0.0M	1.4M	0.0M	2.8M	1.5M	1.3M	2.5M	0.2M
UIMCHp11C5	4.4M	0.0M	0.0M	1.4M	0.0M	2.6M	1.4M	1.2M	2.4M	0.2M
UIMCHp11C6	4.7M	0.0M	0.0M	1.5M	0.0M	2.7M	1.4M	1.3M	2.5M	0.3M
UIfop7C1	2.0M	0.0M	0.0M	0.7M	0.0M	1.0M	0.6M	0.5M	0.9M	0.1M
UIfop7C2	2.0M	0.0M	0.0M	0.7M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIfop7C3	1.7M	0.0M	0.0M	0.6M	0.0M	0.8M	0.5M	0.4M	0.7M	0.1M
UIfop7C4	1.5M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIfop7C5	1.6M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIfop7C6	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIfop8C1	1.9M	0.0M	0.0M	0.7M	0.0M	1.0M	0.6M	0.4M	0.9M	0.1M
UIfop8C2	2.4M	0.0M	0.0M	0.8M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
UIfop8C3	1.9M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIfop8C4	1.4M	0.0M	0.0M	0.5M	0.0M	0.7M	0.4M	0.3M	0.6M	0.1M
UIfop8C5	1.5M	0.0M	0.0M	0.5M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIfop8C6	2.1M	0.0M	0.0M	0.8M	0.0M	1.0M	0.5M	0.4M	0.9M	0.1M
UIprop7B2	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIprop7B3	2.1M	0.0M	0.0M	0.7M	0.0M	1.1M	0.6M	0.5M	1.0M	0.1M
UIprop7B4	2.3M	0.0M	0.0M	0.8M	0.0M	1.2M	0.7M	0.6M	1.1M	0.1M
UIprop7B5	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIprop7B6	1.5M	0.0M	0.0M	0.6M	0.0M	0.8M	0.4M	0.3M	0.7M	0.1M
UIprop8B1	1.7M	0.0M	0.0M	0.6M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
UIprop8B2	2.2M	0.0M	0.0M	0.7M	0.0M	1.2M	0.7M	0.6M	1.1M	0.1M
UIprop8B3	2.7M	0.0M	0.0M	1.0M	0.0M	1.4M	0.8M	0.6M	1.3M	0.1M
UIprop8B4	2.0M	0.0M	0.0M	0.8M	0.0M	1.0M	0.6M	0.5M	0.9M	0.1M
UIprop8B5	2.4M	0.0M	0.0M	0.9M	0.0M	1.3M	0.7M	0.6M	1.1M	0.1M
UIprop8B6	1.9M	0.0M	0.0M	0.8M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
Uiprop7B1	1.8M	0.0M	0.0M	0.7M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: rseqc_bam_stat_table

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non_splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count

Samtools

Toolkit for interacting with BAM/CRAM files.http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Percent mapped

Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.

For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.

Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).

Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.

Created with MultiQC

Alignment stats

This module parses the output from samtools stats. All numbers in millions.

Created with MultiQC

Showing ²⁰⁴/₂₀₄ rows and ¹³/₁₃ columns.

Sample Name	Total sequences	Mapped & paired	Properly paired	Duplicated	QC Failed	Reads MQ0	Mapped bases (CIGAR)	Bases Trimmed	Duplicated bases	Diff chromosomes	Other orientation	Inward pairs	Outward pairs
UI014p1B1	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	81.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p1B2	0.8M	0.0M	0.0M	0.0M	0.0M	0.1M	64.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p1B3	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	83.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p1B4	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	77.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p1B5	0.8M	0.0M	0.0M	0.0M	0.0M	0.1M	63.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p1B6	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	101.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p2B1	0.7M	0.0M	0.0M	0.0M	0.0M	0.1M	57.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p2B2	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	106.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p2B3	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	128.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p2B4	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	122.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p2B5	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	106.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI014p2B6	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	135.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p1C1	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	83.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p1C2	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	82.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p1C3	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	99.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p1C4	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	102.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p1C5	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	43.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p1C6	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	95.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p2C1	0.7M	0.0M	0.0M	0.0M	0.0M	0.1M	51.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p2C2	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	86.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p2C3	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	92.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p2C4	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	100.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p2C5	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	71.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI015p2C6	0.8M	0.0M	0.0M	0.0M	0.0M	0.1M	49.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p1D1	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	69.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p1D2	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	71.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p1D3	0.7M	0.0M	0.0M	0.0M	0.0M	0.1M	55.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p1D4	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	83.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p1D5	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	82.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p1D6	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	92.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p2A1	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	68.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p2A2	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	68.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p2A3	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	92.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p2A4	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	124.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p2A5	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	110.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI016p2A6	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	75.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p3B1	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	42.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p3B2	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	93.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p3B3	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	62.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p3B4	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	60.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p3B5	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	46.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p3B6	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	93.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p4B1	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	60.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p4B2	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	80.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p4B3	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	99.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p4B4	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	37.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p4B5	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	40.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI017p4B6	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	103.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p3C1	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	31.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p3C2	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	81.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p3C3	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	63.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p3C4	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	89.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p3C5	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	53.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p3C6	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	84.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p4C1	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	67.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p4C2	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	67.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p4C3	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	104.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p4C4	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	51.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p4C5	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	59.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI018p4C6	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	74.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p3D1	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	77.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p3D2	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	51.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p3D3	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	51.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p3D4	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	47.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p3D5	0.6M	0.0M	0.0M	0.0M	0.0M	0.1M	43.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p3D6	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	78.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p4A1	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	32.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p4A2	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	32.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p4A3	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	41.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p4A4	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	52.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p4A5	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	62.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI019p4A6	0.7M	0.0M	0.0M	0.0M	0.0M	0.1M	54.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p5B1	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	98.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p5B2	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	107.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p5B3	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	136.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p5B4	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	116.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p5B5	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	83.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p5B6	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	63.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p6B1	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	112.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p6B2	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	137.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p6B3	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	195.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p6B4	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	167.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p6B5	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	155.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI074p6B6	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	157.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p5C1	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	101.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p5C2	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	99.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p5C3	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	103.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p5C4	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	153.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p5C5	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	80.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p5C6	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	80.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p6C1	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	118.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p6C2	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	123.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p6C3	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	135.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p6C4	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	160.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p6C5	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	137.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI075p6C6	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	119.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10B1	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	114.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10B2	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	118.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10B3	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	143.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10B4	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	155.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10B5	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	155.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10B6	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	140.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10C1	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	99.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10C2	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	88.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10C3	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	140.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10C4	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	149.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10C5	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	112.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UI076p10C6	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	110.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A1	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	90.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A2	0.8M	0.0M	0.0M	0.0M	0.0M	0.1M	69.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A3	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	82.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A4	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	89.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A5	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	108.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A6	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	137.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A1	0.8M	0.0M	0.0M	0.0M	0.0M	0.1M	64.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A2	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	128.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A3	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	104.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A4	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	144.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A5	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	133.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A6	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	121.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A1	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	101.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A2	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	85.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A3	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	72.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A4	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	53.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A5	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	76.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A6	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	86.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A1	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	88.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A2	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	116.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A3	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	94.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A4	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	89.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A5	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	106.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A6	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	83.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A1	0.8M	0.0M	0.0M	0.0M	0.0M	0.1M	47.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A2	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	111.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A3	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	117.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A4	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	138.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A5	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	73.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A6	0.9M	0.0M	0.0M	0.0M	0.0M	0.1M	73.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A1	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	121.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A2	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	146.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A3	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	117.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A4	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	158.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A5	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	105.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A6	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	173.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A1	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	120.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A2	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	119.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A3	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	113.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A4	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	138.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A5	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	98.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A6	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	163.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A1	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	125.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A2	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	149.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A3	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	90.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A4	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	106.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A5	1.4M	0.0M	0.0M	0.0M	0.0M	0.1M	131.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A6	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	124.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A1	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	140.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A2	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	143.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A3	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	161.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A4	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	204.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A5	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	165.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A6	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	179.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A1	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	223.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A2	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	220.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A3	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	256.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A4	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	266.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A5	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	251.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A6	3.2M	0.0M	0.0M	0.0M	0.0M	0.1M	292.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11B1	3.3M	0.0M	0.0M	0.0M	0.0M	0.1M	279.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11B2	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	253.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11B3	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	230.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11B4	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	238.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11B5	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	210.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11B6	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	234.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11C1	3.6M	0.0M	0.0M	0.0M	0.0M	0.1M	305.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11C2	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	252.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11C3	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	214.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11C4	3.3M	0.0M	0.0M	0.0M	0.0M	0.1M	289.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11C5	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	271.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIMCHp11C6	3.2M	0.0M	0.0M	0.0M	0.0M	0.1M	293.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop7C1	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	114.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop7C2	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	121.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop7C3	1.0M	0.0M	0.0M	0.0M	0.0M	0.1M	90.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop7C4	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	86.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop7C5	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	86.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop7C6	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	103.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop8C1	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	114.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop8C2	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	149.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop8C3	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	102.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop8C4	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	77.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop8C5	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	85.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIfop8C6	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	108.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop7B2	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	102.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop7B3	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	118.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop7B4	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	137.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop7B5	1.2M	0.0M	0.0M	0.0M	0.0M	0.1M	105.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop7B6	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	84.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop8B1	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	97.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop8B2	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	140.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop8B3	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	152.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop8B4	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	116.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop8B5	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	146.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
UIprop8B6	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	96.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
Uiprop7B1	1.1M	0.0M	0.0M	0.0M	0.0M	0.1M	99.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-stats-dp_table

Sort	Column	Description	ID	Scale
\|\|	Total sequences	Total sequences	`raw_total_sequences`	read_count
\|\|	Mapped & paired	Paired-end technology bit set + both mates mapped	`reads_mapped_and_paired`	read_count
\|\|	Properly paired	Proper-pair bit set	`reads_properly_paired`	read_count
\|\|	Duplicated	PCR or optical duplicate bit set	`reads_duplicated`	read_count
\|\|	QC Failed	QC Failed	`reads_QC_failed`	read_count
\|\|	Reads MQ0	Reads mapped and MQ=0	`reads_MQ0`	read_count
\|\|	Mapped bases (CIGAR)	Mapped bases (CIGAR)	`bases_mapped__cigar`	base_count
\|\|	Bases Trimmed	Bases Trimmed	`bases_trimmed`	base_count
\|\|	Duplicated bases	Duplicated bases	`bases_duplicated`	base_count
\|\|	Diff chromosomes	Pairs on different chromosomes	`pairs_on_different_chromosomes`	read_count
\|\|	Other orientation	Pairs with other orientation	`pairs_with_other_orientation`	read_count
\|\|	Inward pairs	Inward oriented pairs	`inward_oriented_pairs`	read_count
\|\|	Outward pairs	Outward oriented pairs	`outward_oriented_pairs`	read_count

Flagstat

This module parses the output from samtools flagstat

Created with MultiQC

Showing ²⁰⁴/₂₀₄ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
UI014p1B1	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p1B2	1.5M	1.5M	1.5M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p1B3	1.6M	1.6M	1.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p1B4	1.6M	1.6M	1.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p1B5	1.4M	1.4M	1.4M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p1B6	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p2B1	1.4M	1.4M	1.4M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p2B2	2.0M	2.0M	2.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p2B3	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p2B4	2.2M	2.2M	2.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p2B5	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI014p2B6	2.4M	2.4M	2.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p1C1	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p1C2	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p1C3	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p1C4	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p1C5	1.0M	1.0M	1.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p1C6	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p2C1	1.4M	1.4M	1.4M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p2C2	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p2C3	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p2C4	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p2C5	1.3M	1.3M	1.3M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI015p2C6	1.7M	1.7M	1.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p1D1	1.8M	1.8M	1.8M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p1D2	1.6M	1.6M	1.6M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p1D3	1.4M	1.4M	1.4M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p1D4	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p1D5	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p1D6	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p2A1	1.6M	1.6M	1.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p2A2	1.6M	1.6M	1.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p2A3	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p2A4	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p2A5	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI016p2A6	1.9M	1.9M	1.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p3B1	0.7M	0.7M	0.7M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p3B2	1.6M	1.6M	1.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p3B3	1.2M	1.2M	1.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p3B4	1.2M	1.2M	1.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p3B5	1.1M	1.1M	1.1M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p3B6	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p4B1	1.1M	1.1M	1.1M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p4B2	1.5M	1.5M	1.5M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p4B3	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p4B4	0.8M	0.8M	0.8M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p4B5	0.8M	0.8M	0.8M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI017p4B6	1.7M	1.7M	1.7M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p3C1	0.7M	0.7M	0.7M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p3C2	1.4M	1.4M	1.4M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p3C3	1.3M	1.3M	1.3M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p3C4	1.6M	1.6M	1.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p3C5	1.2M	1.2M	1.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p3C6	1.5M	1.5M	1.5M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p4C1	1.3M	1.3M	1.3M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p4C2	1.1M	1.1M	1.1M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p4C3	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p4C4	1.1M	1.1M	1.1M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p4C5	1.2M	1.2M	1.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI018p4C6	1.8M	1.8M	1.8M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p3D1	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p3D2	1.1M	1.1M	1.1M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p3D3	1.0M	1.0M	1.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p3D4	1.2M	1.2M	1.2M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p3D5	1.2M	1.2M	1.2M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p3D6	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p4A1	1.0M	1.0M	1.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p4A2	1.0M	1.0M	1.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p4A3	1.1M	1.1M	1.1M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p4A4	1.1M	1.1M	1.1M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p4A5	1.3M	1.3M	1.3M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI019p4A6	1.5M	1.5M	1.5M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p5B1	2.1M	2.1M	2.1M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p5B2	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p5B3	2.6M	2.6M	2.6M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p5B4	2.2M	2.2M	2.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p5B5	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p5B6	1.3M	1.3M	1.3M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p6B1	2.2M	2.2M	2.2M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p6B2	2.6M	2.6M	2.6M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p6B3	3.4M	3.4M	3.4M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p6B4	3.0M	3.0M	3.0M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p6B5	2.8M	2.8M	2.8M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI074p6B6	2.6M	2.6M	2.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p5C1	2.1M	2.1M	2.1M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p5C2	2.0M	2.0M	2.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p5C3	2.3M	2.3M	2.3M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p5C4	2.8M	2.8M	2.8M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p5C5	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p5C6	1.5M	1.5M	1.5M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p6C1	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p6C2	2.4M	2.4M	2.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p6C3	2.6M	2.6M	2.6M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p6C4	2.9M	2.9M	2.9M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p6C5	2.3M	2.3M	2.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI075p6C6	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10B1	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10B2	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10B3	2.5M	2.5M	2.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10B4	2.6M	2.6M	2.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10B5	2.7M	2.7M	2.7M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10B6	2.4M	2.4M	2.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10C1	2.0M	2.0M	2.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10C2	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10C3	2.5M	2.5M	2.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10C4	2.5M	2.5M	2.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10C5	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UI076p10C6	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A1	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A2	1.5M	1.5M	1.5M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A3	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A4	1.8M	1.8M	1.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A5	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp1A6	2.9M	2.9M	2.9M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A1	1.6M	1.6M	1.6M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A2	2.4M	2.4M	2.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A3	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A4	2.6M	2.6M	2.6M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A5	2.2M	2.2M	2.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp2A6	2.4M	2.4M	2.4M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A1	1.8M	1.8M	1.8M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A2	1.5M	1.5M	1.5M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A3	1.4M	1.4M	1.4M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A4	0.9M	0.9M	0.9M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A5	1.4M	1.4M	1.4M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp3A6	1.6M	1.6M	1.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A1	1.6M	1.6M	1.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A2	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A3	1.7M	1.7M	1.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A4	1.6M	1.6M	1.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A5	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp4A6	1.9M	1.9M	1.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A1	1.7M	1.7M	1.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A2	2.2M	2.2M	2.2M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A3	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A4	2.5M	2.5M	2.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A5	1.6M	1.6M	1.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp5A6	1.6M	1.6M	1.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A1	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A2	2.8M	2.8M	2.8M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A3	2.3M	2.3M	2.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A4	2.9M	2.9M	2.9M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A5	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp6A6	3.2M	3.2M	3.2M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A1	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A2	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A3	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A4	2.2M	2.2M	2.2M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A5	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp7A6	2.6M	2.6M	2.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A1	2.1M	2.1M	2.1M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A2	2.5M	2.5M	2.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A3	1.4M	1.4M	1.4M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A4	1.8M	1.8M	1.8M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A5	2.2M	2.2M	2.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp8A6	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A1	2.5M	2.5M	2.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A2	2.6M	2.6M	2.6M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A3	3.0M	3.0M	3.0M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A4	3.5M	3.5M	3.5M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A5	2.8M	2.8M	2.8M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp10A6	2.9M	2.9M	2.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A1	4.1M	4.1M	4.1M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A2	3.7M	3.7M	3.7M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A3	4.4M	4.4M	4.4M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A4	4.4M	4.4M	4.4M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A5	4.3M	4.3M	4.3M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIDMSOp11A6	4.5M	4.5M	4.5M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11B1	4.9M	4.9M	4.9M	1.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11B2	4.4M	4.4M	4.4M	1.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11B3	4.0M	4.0M	4.0M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11B4	4.1M	4.1M	4.1M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11B5	3.5M	3.5M	3.5M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11B6	3.7M	3.7M	3.7M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11C1	5.5M	5.5M	5.5M	1.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11C2	4.3M	4.3M	4.3M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11C3	3.7M	3.7M	3.7M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11C4	4.7M	4.7M	4.7M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11C5	4.4M	4.4M	4.4M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIMCHp11C6	4.7M	4.7M	4.7M	1.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop7C1	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop7C2	2.0M	2.0M	2.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop7C3	1.7M	1.7M	1.7M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop7C4	1.5M	1.5M	1.5M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop7C5	1.6M	1.6M	1.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop7C6	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop8C1	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop8C2	2.4M	2.4M	2.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop8C3	1.9M	1.9M	1.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop8C4	1.4M	1.4M	1.4M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop8C5	1.5M	1.5M	1.5M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIfop8C6	2.1M	2.1M	2.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop7B2	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop7B3	2.1M	2.1M	2.1M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop7B4	2.3M	2.3M	2.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop7B5	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop7B6	1.5M	1.5M	1.5M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop8B1	1.7M	1.7M	1.7M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop8B2	2.2M	2.2M	2.2M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop8B3	2.7M	2.7M	2.7M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop8B4	2.0M	2.0M	2.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop8B5	2.4M	2.4M	2.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
UIprop8B6	1.9M	1.9M	1.9M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
Uiprop7B1	1.8M	1.8M	1.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-table_table

Sort	Column	Description	ID	Scale
\|\|	Total Reads	Total Reads	`flagstat_total`	read_count
\|\|	Total Passed QC	Total Passed QC	`total_passed`	read_count
\|\|	Mapped	Mapped	`mapped_passed`	read_count
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed`	read_count
\|\|	Duplicates	Duplicates	`duplicates_passed`	read_count
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed`	read_count
\|\|	Properly Paired	Properly Paired	`properly_paired_passed`	read_count
\|\|	Self and mate mapped	Reads with itself and mate mapped	`with_itself_and_mate_mapped_passed`	read_count
\|\|	Singletons	Singletons	`singletons_passed`	read_count
\|\|	Mate mapped to diff chr	Mate mapped to different chromosome	`with_mate_mapped_to_a_different_chr_passed`	read_count
\|\|	Diff chr (mapQ >= 5)	Mate mapped to different chromosome (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed`	read_count

Flagstat: Percentage of total

This module parses the output from samtools flagstat

Created with MultiQC

Showing ²⁰⁴/₂₀₄ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
UI014p1B1	100.0%	100.0%	100.0%	42.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p1B2	100.0%	100.0%	100.0%	47.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p1B3	100.0%	100.0%	100.0%	40.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p1B4	100.0%	100.0%	100.0%	42.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p1B5	100.0%	100.0%	100.0%	45.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p1B6	100.0%	100.0%	100.0%	38.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p2B1	100.0%	100.0%	100.0%	46.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p2B2	100.0%	100.0%	100.0%	39.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p2B3	100.0%	100.0%	100.0%	37.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p2B4	100.0%	100.0%	100.0%	37.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p2B5	100.0%	100.0%	100.0%	37.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI014p2B6	100.0%	100.0%	100.0%	37.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p1C1	100.0%	100.0%	100.0%	42.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p1C2	100.0%	100.0%	100.0%	45.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p1C3	100.0%	100.0%	100.0%	39.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p1C4	100.0%	100.0%	100.0%	38.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p1C5	100.0%	100.0%	100.0%	46.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p1C6	100.0%	100.0%	100.0%	39.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p2C1	100.0%	100.0%	100.0%	49.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p2C2	100.0%	100.0%	100.0%	43.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p2C3	100.0%	100.0%	100.0%	41.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p2C4	100.0%	100.0%	100.0%	38.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p2C5	100.0%	100.0%	100.0%	39.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI015p2C6	100.0%	100.0%	100.0%	51.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p1D1	100.0%	100.0%	100.0%	48.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p1D2	100.0%	100.0%	100.0%	45.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p1D3	100.0%	100.0%	100.0%	48.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p1D4	100.0%	100.0%	100.0%	44.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p1D5	100.0%	100.0%	100.0%	41.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p1D6	100.0%	100.0%	100.0%	38.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p2A1	100.0%	100.0%	100.0%	46.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p2A2	100.0%	100.0%	100.0%	45.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p2A3	100.0%	100.0%	100.0%	40.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p2A4	100.0%	100.0%	100.0%	38.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p2A5	100.0%	100.0%	100.0%	39.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI016p2A6	100.0%	100.0%	100.0%	46.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p3B1	100.0%	100.0%	100.0%	37.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p3B2	100.0%	100.0%	100.0%	36.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p3B3	100.0%	100.0%	100.0%	41.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p3B4	100.0%	100.0%	100.0%	40.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p3B5	100.0%	100.0%	100.0%	46.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p3B6	100.0%	100.0%	100.0%	39.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p4B1	100.0%	100.0%	100.0%	36.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p4B2	100.0%	100.0%	100.0%	39.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p4B3	100.0%	100.0%	100.0%	38.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p4B4	100.0%	100.0%	100.0%	44.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p4B5	100.0%	100.0%	100.0%	39.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI017p4B6	100.0%	100.0%	100.0%	34.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p3C1	100.0%	100.0%	100.0%	44.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p3C2	100.0%	100.0%	100.0%	35.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p3C3	100.0%	100.0%	100.0%	42.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p3C4	100.0%	100.0%	100.0%	37.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p3C5	100.0%	100.0%	100.0%	44.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p3C6	100.0%	100.0%	100.0%	38.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p4C1	100.0%	100.0%	100.0%	39.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p4C2	100.0%	100.0%	100.0%	35.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p4C3	100.0%	100.0%	100.0%	38.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p4C4	100.0%	100.0%	100.0%	43.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p4C5	100.0%	100.0%	100.0%	41.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI018p4C6	100.0%	100.0%	100.0%	47.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p3D1	100.0%	100.0%	100.0%	45.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p3D2	100.0%	100.0%	100.0%	43.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p3D3	100.0%	100.0%	100.0%	42.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p3D4	100.0%	100.0%	100.0%	47.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p3D5	100.0%	100.0%	100.0%	51.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p3D6	100.0%	100.0%	100.0%	44.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p4A1	100.0%	100.0%	100.0%	53.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p4A2	100.0%	100.0%	100.0%	53.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p4A3	100.0%	100.0%	100.0%	49.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p4A4	100.0%	100.0%	100.0%	42.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p4A5	100.0%	100.0%	100.0%	42.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI019p4A6	100.0%	100.0%	100.0%	51.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p5B1	100.0%	100.0%	100.0%	42.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p5B2	100.0%	100.0%	100.0%	39.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p5B3	100.0%	100.0%	100.0%	38.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p5B4	100.0%	100.0%	100.0%	38.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p5B5	100.0%	100.0%	100.0%	43.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p5B6	100.0%	100.0%	100.0%	41.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p6B1	100.0%	100.0%	100.0%	39.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p6B2	100.0%	100.0%	100.0%	37.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p6B3	100.0%	100.0%	100.0%	34.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p6B4	100.0%	100.0%	100.0%	35.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p6B5	100.0%	100.0%	100.0%	36.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI074p6B6	100.0%	100.0%	100.0%	34.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p5C1	100.0%	100.0%	100.0%	41.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p5C2	100.0%	100.0%	100.0%	39.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p5C3	100.0%	100.0%	100.0%	43.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p5C4	100.0%	100.0%	100.0%	37.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p5C5	100.0%	100.0%	100.0%	42.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p5C6	100.0%	100.0%	100.0%	39.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p6C1	100.0%	100.0%	100.0%	39.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p6C2	100.0%	100.0%	100.0%	38.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p6C3	100.0%	100.0%	100.0%	38.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p6C4	100.0%	100.0%	100.0%	35.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p6C5	100.0%	100.0%	100.0%	34.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI075p6C6	100.0%	100.0%	100.0%	37.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10B1	100.0%	100.0%	100.0%	40.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10B2	100.0%	100.0%	100.0%	37.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10B3	100.0%	100.0%	100.0%	35.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10B4	100.0%	100.0%	100.0%	35.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10B5	100.0%	100.0%	100.0%	36.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10B6	100.0%	100.0%	100.0%	35.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10C1	100.0%	100.0%	100.0%	41.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10C2	100.0%	100.0%	100.0%	42.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10C3	100.0%	100.0%	100.0%	36.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10C4	100.0%	100.0%	100.0%	34.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10C5	100.0%	100.0%	100.0%	36.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UI076p10C6	100.0%	100.0%	100.0%	36.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp1A1	100.0%	100.0%	100.0%	41.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp1A2	100.0%	100.0%	100.0%	44.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp1A3	100.0%	100.0%	100.0%	42.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp1A4	100.0%	100.0%	100.0%	42.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp1A5	100.0%	100.0%	100.0%	37.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp1A6	100.0%	100.0%	100.0%	42.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp2A1	100.0%	100.0%	100.0%	47.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp2A2	100.0%	100.0%	100.0%	38.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp2A3	100.0%	100.0%	100.0%	41.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp2A4	100.0%	100.0%	100.0%	37.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp2A5	100.0%	100.0%	100.0%	34.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp2A6	100.0%	100.0%	100.0%	40.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp3A1	100.0%	100.0%	100.0%	36.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp3A2	100.0%	100.0%	100.0%	36.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp3A3	100.0%	100.0%	100.0%	40.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp3A4	100.0%	100.0%	100.0%	37.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp3A5	100.0%	100.0%	100.0%	37.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp3A6	100.0%	100.0%	100.0%	38.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp4A1	100.0%	100.0%	100.0%	38.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp4A2	100.0%	100.0%	100.0%	35.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp4A3	100.0%	100.0%	100.0%	38.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp4A4	100.0%	100.0%	100.0%	36.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp4A5	100.0%	100.0%	100.0%	40.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp4A6	100.0%	100.0%	100.0%	46.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp5A1	100.0%	100.0%	100.0%	52.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp5A2	100.0%	100.0%	100.0%	39.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp5A3	100.0%	100.0%	100.0%	39.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp5A4	100.0%	100.0%	100.0%	36.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp5A5	100.0%	100.0%	100.0%	42.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp5A6	100.0%	100.0%	100.0%	42.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp6A1	100.0%	100.0%	100.0%	38.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp6A2	100.0%	100.0%	100.0%	38.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp6A3	100.0%	100.0%	100.0%	39.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp6A4	100.0%	100.0%	100.0%	36.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp6A5	100.0%	100.0%	100.0%	38.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp6A6	100.0%	100.0%	100.0%	36.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp7A1	100.0%	100.0%	100.0%	33.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp7A2	100.0%	100.0%	100.0%	34.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp7A3	100.0%	100.0%	100.0%	36.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp7A4	100.0%	100.0%	100.0%	33.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp7A5	100.0%	100.0%	100.0%	38.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp7A6	100.0%	100.0%	100.0%	33.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp8A1	100.0%	100.0%	100.0%	35.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp8A2	100.0%	100.0%	100.0%	34.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp8A3	100.0%	100.0%	100.0%	33.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp8A4	100.0%	100.0%	100.0%	35.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp8A5	100.0%	100.0%	100.0%	35.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp8A6	100.0%	100.0%	100.0%	34.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp10A1	100.0%	100.0%	100.0%	37.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp10A2	100.0%	100.0%	100.0%	37.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp10A3	100.0%	100.0%	100.0%	37.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp10A4	100.0%	100.0%	100.0%	35.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp10A5	100.0%	100.0%	100.0%	35.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp10A6	100.0%	100.0%	100.0%	33.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp11A1	100.0%	100.0%	100.0%	33.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp11A2	100.0%	100.0%	100.0%	31.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp11A3	100.0%	100.0%	100.0%	32.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp11A4	100.0%	100.0%	100.0%	30.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp11A5	100.0%	100.0%	100.0%	32.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIDMSOp11A6	100.0%	100.0%	100.0%	29.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11B1	100.0%	100.0%	100.0%	31.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11B2	100.0%	100.0%	100.0%	33.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11B3	100.0%	100.0%	100.0%	33.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11B4	100.0%	100.0%	100.0%	33.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11B5	100.0%	100.0%	100.0%	32.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11B6	100.0%	100.0%	100.0%	30.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11C1	100.0%	100.0%	100.0%	33.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11C2	100.0%	100.0%	100.0%	33.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11C3	100.0%	100.0%	100.0%	33.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11C4	100.0%	100.0%	100.0%	30.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11C5	100.0%	100.0%	100.0%	31.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIMCHp11C6	100.0%	100.0%	100.0%	31.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop7C1	100.0%	100.0%	100.0%	36.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop7C2	100.0%	100.0%	100.0%	34.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop7C3	100.0%	100.0%	100.0%	38.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop7C4	100.0%	100.0%	100.0%	36.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop7C5	100.0%	100.0%	100.0%	38.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop7C6	100.0%	100.0%	100.0%	37.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop8C1	100.0%	100.0%	100.0%	35.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop8C2	100.0%	100.0%	100.0%	33.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop8C3	100.0%	100.0%	100.0%	38.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop8C4	100.0%	100.0%	100.0%	37.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop8C5	100.0%	100.0%	100.0%	36.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIfop8C6	100.0%	100.0%	100.0%	40.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop7B2	100.0%	100.0%	100.0%	36.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop7B3	100.0%	100.0%	100.0%	36.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop7B4	100.0%	100.0%	100.0%	34.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop7B5	100.0%	100.0%	100.0%	36.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop7B6	100.0%	100.0%	100.0%	37.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop8B1	100.0%	100.0%	100.0%	36.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop8B2	100.0%	100.0%	100.0%	31.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop8B3	100.0%	100.0%	100.0%	36.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop8B4	100.0%	100.0%	100.0%	36.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop8B5	100.0%	100.0%	100.0%	35.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
UIprop8B6	100.0%	100.0%	100.0%	40.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
Uiprop7B1	100.0%	100.0%	100.0%	37.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-pct-table_table

Sort	Column	Description	ID
\|\|	Total Reads	Total Reads	`flagstat_total_pct`
\|\|	Total Passed QC	Total Passed QC	`total_passed_pct`
\|\|	Mapped	Mapped	`mapped_passed_pct`
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed_pct`
\|\|	Duplicates	Duplicates	`duplicates_passed_pct`
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed_pct`
\|\|	Properly Paired	Properly Paired	`properly_paired_passed_pct`
\|\|	Self and mate mapped	Self and mate mapped	`with_itself_and_mate_mapped_passed_pct`
\|\|	Singletons	Singletons	`singletons_passed_pct`
\|\|	Mate mapped to diff chr	Mate mapped to diff chr	`with_mate_mapped_to_a_different_chr_passed_pct`
\|\|	Diff chr (mapQ >= 5)	Diff chr (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed_pct`

Mapped reads per contig

The samtools idxstats tool counts the number of mapped reads per chromosome / contig. Chromosomes with < 0.1% of the total aligned reads are omitted from this plot.

Created with MultiQC

STAR

Universal RNA-seq aligner.https://github.com/alexdobin/STARDOI: 10.1093/bioinformatics/bts635

Summary Statistics

Summary statistics from the STAR alignment

Showing ²⁰⁴/₂₀₄ rows and ¹⁰/₁₉ columns.

Sample Name	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	Avg. read len	Avg. mapped len	Splices	Annotated splices	GT/AG splices	GC/AG splices	AT/AC splices	Non-canonical splices	Mismatch rate	Del rate	Del len	Ins rate	Ins len
UI014p1B1	9.8M	9.0M	92.5%	7.6M	77.5%	1.5M	90.0bp	98.2bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p1B2	13.6M	12.5M	91.6%	9.9M	72.5%	2.6M	92.0bp	101.2bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.4bp
UI014p1B3	9.4M	8.9M	95.0%	7.4M	79.0%	1.5M	96.0bp	102.6bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p1B4	15.6M	14.8M	95.0%	12.4M	79.5%	2.4M	97.0bp	103.3bp	1.7M	1.7M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UI014p1B5	14.2M	13.0M	91.6%	10.7M	75.5%	2.3M	92.0bp	101.5bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p1B6	13.2M	12.3M	93.1%	10.3M	78.3%	2.0M	94.0bp	102.5bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p2B1	11.5M	10.6M	92.4%	9.0M	77.9%	1.7M	91.0bp	99.3bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p2B2	11.6M	10.9M	94.2%	9.3M	79.9%	1.7M	93.0bp	99.9bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p2B3	14.2M	13.5M	95.0%	11.5M	81.1%	2.0M	95.0bp	100.5bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p2B4	14.7M	14.0M	95.3%	11.8M	80.1%	2.2M	96.0bp	101.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p2B5	16.7M	16.0M	95.8%	13.8M	82.6%	2.2M	98.0bp	103.0bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI014p2B6	14.8M	13.8M	93.2%	11.8M	80.0%	1.9M	96.0bp	104.0bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UI015p1C1	11.9M	11.2M	93.8%	9.5M	79.4%	1.7M	94.0bp	101.3bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI015p1C2	13.3M	12.0M	90.6%	9.8M	74.2%	2.2M	89.0bp	99.8bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI015p1C3	12.5M	11.9M	95.2%	9.9M	79.3%	2.0M	96.0bp	101.9bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI015p1C4	12.4M	11.8M	95.0%	9.8M	79.3%	2.0M	96.0bp	103.0bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI015p1C5	9.0M	8.2M	91.3%	6.8M	76.2%	1.4M	92.0bp	101.8bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI015p1C6	14.3M	13.4M	93.3%	11.3M	79.2%	2.0M	95.0bp	102.6bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI015p2C1	13.7M	12.4M	90.1%	10.3M	75.3%	2.0M	88.0bp	99.6bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.2bp
UI015p2C2	12.9M	11.9M	91.9%	9.9M	76.3%	2.0M	88.0bp	98.1bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.2bp
UI015p2C3	14.4M	13.6M	94.3%	11.5M	80.1%	2.1M	93.0bp	99.6bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.2bp
UI015p2C4	11.7M	11.1M	95.0%	9.6M	81.5%	1.6M	94.0bp	99.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.3bp
UI015p2C5	13.1M	12.4M	95.1%	10.8M	82.5%	1.6M	98.0bp	104.1bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.2bp
UI015p2C6	5.4M	3.8M	71.3%	2.7M	50.6%	1.1M	50.0bp	65.7bp	0.2M	0.2M	0.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.3bp
UI016p1D1	8.5M	6.9M	80.8%	5.5M	64.0%	1.4M	71.0bp	87.3bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p1D2	9.0M	8.1M	90.3%	6.7M	75.2%	1.4M	88.0bp	98.5bp	0.8M	0.8M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p1D3	10.5M	9.4M	89.4%	7.8M	74.0%	1.6M	88.0bp	99.8bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI016p1D4	10.9M	9.9M	91.1%	8.3M	76.4%	1.6M	90.0bp	100.1bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UI016p1D5	12.1M	11.3M	93.4%	9.5M	79.0%	1.7M	93.0bp	100.6bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p1D6	10.2M	9.4M	92.2%	8.0M	78.3%	1.4M	94.0bp	102.6bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p2A1	8.9M	8.1M	90.2%	6.4M	71.6%	1.7M	87.0bp	97.2bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.5%	0.0%	1.7bp	0.0%	1.4bp
UI016p2A2	9.2M	8.4M	90.6%	7.0M	75.7%	1.4M	89.0bp	98.9bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p2A3	11.5M	10.8M	94.0%	9.2M	79.8%	1.6M	93.0bp	99.9bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p2A4	12.2M	11.3M	93.2%	9.5M	78.0%	1.8M	94.0bp	101.9bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p2A5	11.5M	10.8M	93.6%	9.1M	79.5%	1.6M	95.0bp	102.2bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI016p2A6	7.0M	5.6M	81.1%	4.5M	64.2%	1.2M	68.0bp	82.8bp	0.3M	0.3M	0.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI017p3B1	10.0M	9.7M	96.7%	8.4M	83.6%	1.3M	106.0bp	109.8bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.1%	1.1bp
UI017p3B2	11.9M	11.5M	96.3%	9.8M	82.5%	1.7M	101.0bp	104.9bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI017p3B3	13.3M	12.7M	95.6%	11.0M	82.3%	1.8M	103.0bp	108.1bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI017p3B4	14.5M	13.8M	95.2%	11.9M	81.9%	1.9M	102.0bp	107.2bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.1%	1.1bp
UI017p3B5	17.5M	16.4M	93.4%	13.9M	79.2%	2.5M	97.0bp	104.1bp	1.8M	1.8M	1.8M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UI017p3B6	14.9M	14.2M	94.9%	12.0M	80.5%	2.1M	100.0bp	106.7bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI017p4B1	9.3M	9.0M	96.4%	7.7M	83.3%	1.2M	104.0bp	107.5bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.1%	1.1bp
UI017p4B2	12.9M	12.3M	95.8%	10.4M	80.7%	1.9M	100.0bp	105.4bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI017p4B3	17.2M	16.5M	95.7%	14.1M	81.9%	2.4M	98.0bp	103.2bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI017p4B4	12.1M	11.5M	95.1%	9.8M	81.3%	1.7M	103.0bp	108.9bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UI017p4B5	13.0M	12.4M	95.7%	10.7M	82.7%	1.7M	104.0bp	109.4bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UI017p4B6	13.9M	13.3M	95.8%	11.6M	83.0%	1.8M	105.0bp	109.7bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p3C1	11.6M	11.0M	94.4%	9.4M	80.6%	1.6M	102.0bp	108.6bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI018p3C2	8.7M	8.4M	96.4%	7.2M	82.8%	1.2M	102.0bp	106.2bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI018p3C3	11.8M	11.1M	94.1%	9.4M	79.1%	1.8M	95.0bp	102.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI018p3C4	13.1M	12.6M	96.1%	10.7M	82.1%	1.8M	102.0bp	106.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI018p3C5	13.3M	12.5M	93.8%	10.6M	79.8%	1.9M	96.0bp	103.0bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p3C6	10.9M	10.3M	94.6%	8.7M	80.2%	1.6M	102.0bp	107.8bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p4C1	10.7M	10.1M	95.1%	8.6M	80.5%	1.5M	101.0bp	107.1bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p4C2	10.4M	10.1M	96.6%	8.7M	83.5%	1.4M	104.0bp	107.9bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p4C3	14.7M	14.1M	95.6%	12.0M	81.4%	2.1M	97.0bp	102.5bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p4C4	11.6M	11.0M	94.4%	9.4M	80.6%	1.6M	101.0bp	107.0bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UI018p4C5	15.1M	14.4M	95.4%	12.3M	81.5%	2.1M	102.0bp	108.1bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI018p4C6	8.2M	7.0M	85.1%	5.4M	65.5%	1.6M	75.0bp	88.1bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.5bp
UI019p3D1	9.4M	8.5M	90.1%	7.1M	75.0%	1.4M	88.0bp	98.5bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI019p3D2	8.9M	8.4M	94.3%	7.1M	79.8%	1.3M	99.0bp	105.2bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UI019p3D3	9.2M	8.7M	94.7%	7.5M	80.9%	1.3M	100.0bp	105.8bp	0.9M	0.9M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UI019p3D4	9.6M	8.8M	92.1%	7.3M	76.4%	1.5M	96.0bp	105.6bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI019p3D5	12.3M	11.1M	89.9%	9.2M	74.9%	1.8M	92.0bp	103.2bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UI019p3D6	14.4M	13.4M	92.7%	11.3M	78.4%	2.1M	96.0bp	104.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI019p4A1	9.2M	8.1M	87.9%	6.7M	72.8%	1.4M	90.0bp	102.8bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI019p4A2	10.4M	9.2M	88.8%	7.6M	73.6%	1.6M	90.0bp	101.8bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI019p4A3	9.8M	9.0M	91.0%	7.5M	76.4%	1.4M	93.0bp	102.5bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI019p4A4	10.7M	10.0M	94.2%	8.6M	80.5%	1.5M	101.0bp	106.8bp	1.0M	1.0M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI019p4A5	11.2M	10.6M	93.9%	8.9M	79.5%	1.6M	101.0bp	107.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UI019p4A6	8.9M	7.5M	83.9%	6.1M	68.1%	1.4M	83.0bp	100.0bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UI074p5B1	6.2M	5.4M	85.9%	4.4M	70.7%	1.0M	81.0bp	93.2bp	0.5M	0.5M	0.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI074p5B2	8.1M	7.4M	91.2%	6.2M	76.4%	1.2M	88.0bp	96.8bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.0%	1.1bp
UI074p5B3	9.6M	8.7M	89.9%	7.2M	75.2%	1.4M	86.0bp	95.4bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI074p5B4	8.5M	7.6M	89.7%	6.4M	75.7%	1.2M	89.0bp	99.2bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI074p5B5	9.8M	8.1M	83.1%	6.7M	68.9%	1.4M	82.0bp	97.9bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI074p5B6	6.5M	5.8M	88.8%	4.9M	74.7%	0.9M	89.0bp	100.3bp	0.6M	0.6M	0.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI074p6B1	8.0M	7.1M	89.0%	5.9M	74.7%	1.1M	87.0bp	97.5bp	0.6M	0.6M	0.6M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.0%	1.1bp
UI074p6B2	8.9M	8.0M	89.5%	6.7M	74.7%	1.3M	83.0bp	92.5bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI074p6B3	10.5M	9.6M	91.9%	8.1M	77.4%	1.5M	86.0bp	94.0bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UI074p6B4	10.9M	10.1M	92.6%	8.2M	75.1%	1.9M	88.0bp	95.0bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.4bp
UI074p6B5	12.0M	10.9M	90.7%	8.9M	74.3%	2.0M	90.0bp	98.1bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.5bp
UI074p6B6	9.8M	8.8M	89.8%	7.3M	74.6%	1.5M	89.0bp	98.1bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.4bp
UI075p5C1	6.9M	6.0M	87.0%	5.0M	71.9%	1.0M	82.0bp	94.0bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p5C2	7.9M	7.2M	90.5%	5.9M	74.5%	1.3M	87.0bp	97.1bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p5C3	9.4M	8.2M	86.4%	6.7M	70.8%	1.5M	81.0bp	93.8bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p5C4	14.6M	13.5M	92.6%	11.4M	78.0%	2.1M	90.0bp	97.7bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UI075p5C5	8.5M	7.5M	88.6%	6.3M	74.1%	1.2M	87.0bp	98.2bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI075p5C6	8.3M	7.3M	88.6%	6.2M	75.0%	1.1M	91.0bp	102.2bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p6C1	8.1M	7.2M	88.8%	6.0M	74.3%	1.2M	86.0bp	97.3bp	0.7M	0.7M	0.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p6C2	9.5M	8.7M	91.2%	7.3M	76.3%	1.4M	85.0bp	93.8bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p6C3	8.9M	8.0M	89.8%	6.5M	73.7%	1.4M	84.0bp	94.1bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p6C4	11.4M	10.7M	93.8%	9.1M	79.6%	1.6M	89.0bp	94.8bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p6C5	9.9M	9.2M	92.2%	7.8M	78.8%	1.3M	92.0bp	99.5bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI075p6C6	13.8M	12.7M	92.0%	10.9M	78.9%	1.8M	95.0bp	102.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI076p10B1	13.1M	12.3M	93.6%	10.1M	77.4%	2.1M	90.0bp	97.9bp	1.1M	1.1M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI076p10B2	10.0M	9.5M	95.1%	8.0M	80.4%	1.5M	93.0bp	99.2bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UI076p10B3	13.4M	12.9M	96.1%	11.0M	82.0%	1.9M	95.0bp	99.6bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI076p10B4	15.0M	14.4M	96.3%	12.2M	81.1%	2.3M	96.0bp	101.0bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI076p10B5	18.6M	17.8M	95.8%	15.2M	81.8%	2.6M	95.0bp	99.9bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UI076p10B6	16.9M	16.1M	95.6%	13.7M	81.4%	2.4M	97.0bp	102.7bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UI076p10C1	9.8M	9.1M	92.5%	7.5M	76.2%	1.6M	89.0bp	98.0bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UI076p10C2	10.5M	9.8M	93.4%	8.1M	76.7%	1.8M	91.0bp	99.1bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UI076p10C3	12.7M	12.1M	95.9%	10.4M	81.9%	1.8M	95.0bp	99.6bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UI076p10C4	13.3M	12.7M	96.0%	10.9M	82.5%	1.8M	96.0bp	101.2bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UI076p10C5	12.2M	11.6M	95.3%	9.8M	80.2%	1.8M	95.0bp	101.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UI076p10C6	11.8M	11.1M	94.1%	9.4M	79.5%	1.7M	95.0bp	102.9bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.5%	0.0%	1.9bp	0.0%	1.1bp
UIDMSOp1A1	9.1M	8.4M	91.3%	6.9M	75.5%	1.4M	90.0bp	99.8bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp1A2	11.6M	10.5M	90.6%	8.8M	75.8%	1.7M	91.0bp	100.8bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp1A3	12.2M	11.3M	92.9%	9.3M	76.6%	2.0M	93.0bp	101.1bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UIDMSOp1A4	11.5M	10.6M	91.7%	8.8M	76.1%	1.8M	91.0bp	101.3bp	1.1M	1.1M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp1A5	10.7M	10.0M	93.4%	8.5M	79.6%	1.5M	95.0bp	101.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp1A6	15.0M	12.8M	85.7%	10.5M	70.1%	2.3M	76.0bp	88.1bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp2A1	12.0M	10.8M	90.5%	9.0M	75.4%	1.8M	88.0bp	98.4bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp2A2	11.8M	11.2M	94.7%	9.3M	78.6%	1.9M	92.0bp	98.8bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp2A3	13.1M	12.0M	91.8%	10.1M	77.2%	1.9M	90.0bp	98.4bp	1.2M	1.2M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp2A4	12.7M	12.0M	94.3%	10.0M	78.7%	2.0M	93.0bp	100.3bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp2A5	11.6M	11.0M	95.2%	9.5M	82.0%	1.5M	97.0bp	102.2bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp2A6	12.3M	10.7M	87.0%	8.7M	70.8%	2.0M	76.0bp	86.7bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.5%	0.0%	1.9bp	0.0%	1.4bp
UIDMSOp3A1	10.1M	9.6M	94.7%	8.2M	80.7%	1.4M	98.0bp	103.4bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp3A2	13.0M	12.5M	95.8%	10.6M	81.7%	1.8M	101.0bp	106.4bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp3A3	11.6M	10.9M	94.0%	9.4M	80.5%	1.6M	96.0bp	102.5bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp3A4	12.6M	12.1M	95.8%	10.3M	81.8%	1.8M	104.0bp	109.0bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp3A5	13.1M	12.4M	94.6%	10.6M	81.1%	1.8M	98.0bp	103.5bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp3A6	13.4M	12.2M	91.1%	10.4M	77.5%	1.8M	93.0bp	102.1bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp4A1	11.3M	10.7M	94.8%	9.2M	81.6%	1.5M	98.0bp	104.0bp	1.1M	1.1M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp4A2	12.4M	11.9M	95.8%	10.3M	82.7%	1.6M	100.0bp	104.7bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.1%	1.1bp
UIDMSOp4A3	14.7M	14.0M	95.3%	12.1M	82.1%	2.0M	99.0bp	104.0bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	1.9bp	0.1%	1.0bp
UIDMSOp4A4	14.9M	14.3M	95.9%	12.2M	81.9%	2.1M	103.0bp	108.0bp	1.7M	1.7M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp4A5	15.4M	14.1M	91.6%	11.8M	76.6%	2.3M	92.0bp	101.2bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp4A6	14.7M	12.5M	84.8%	10.3M	69.8%	2.2M	81.0bp	95.3bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp5A1	3.8M	2.1M	55.6%	1.5M	38.9%	0.6M	48.0bp	70.0bp	0.1M	0.1M	0.1M	0.0M	0.0M	0.0M	0.7%	0.0%	1.7bp	0.0%	1.1bp
UIDMSOp5A2	6.4M	5.5M	86.2%	4.6M	71.1%	1.0M	82.0bp	93.7bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp5A3	7.4M	6.6M	89.1%	5.5M	74.2%	1.1M	84.0bp	94.2bp	0.6M	0.6M	0.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp5A4	8.9M	8.0M	89.7%	6.7M	75.3%	1.3M	86.0bp	95.2bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp5A5	5.6M	4.7M	83.7%	3.8M	68.5%	0.8M	80.0bp	94.8bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp5A6	3.3M	2.3M	69.4%	1.8M	55.0%	0.5M	65.0bp	87.2bp	0.2M	0.2M	0.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp6A1	6.5M	5.6M	86.3%	4.7M	72.0%	0.9M	81.0bp	93.4bp	0.4M	0.4M	0.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp6A2	8.8M	7.9M	89.8%	6.6M	74.7%	1.3M	84.0bp	93.2bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp6A3	6.9M	5.8M	84.7%	4.8M	69.7%	1.0M	79.0bp	92.2bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp6A4	8.5M	7.5M	88.7%	6.2M	73.0%	1.3M	84.0bp	94.8bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp6A5	6.3M	5.1M	81.8%	4.1M	64.9%	1.1M	76.0bp	89.9bp	0.4M	0.4M	0.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.5bp
UIDMSOp6A6	7.3M	6.1M	83.4%	5.0M	69.2%	1.0M	81.0bp	93.8bp	0.6M	0.6M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UIDMSOp7A1	10.0M	9.6M	96.3%	8.2M	82.4%	1.4M	100.0bp	104.0bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp7A2	11.7M	11.3M	96.7%	9.5M	81.5%	1.8M	102.0bp	105.9bp	1.2M	1.2M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	1.9bp	0.1%	1.1bp
UIDMSOp7A3	12.6M	12.1M	96.1%	9.8M	77.8%	2.3M	99.0bp	102.6bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.3bp
UIDMSOp7A4	17.5M	16.9M	97.1%	13.9M	79.7%	3.0M	104.0bp	106.3bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.4bp
UIDMSOp7A5	19.2M	18.3M	95.2%	15.8M	81.9%	2.6M	100.0bp	104.9bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.1%	1.1bp
UIDMSOp7A6	17.5M	16.8M	95.6%	14.5M	82.6%	2.3M	101.0bp	105.4bp	1.9M	1.9M	1.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp8A1	11.0M	10.6M	95.8%	8.7M	79.0%	1.9M	99.0bp	102.8bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.3bp
UIDMSOp8A2	14.0M	13.5M	96.2%	11.3M	80.8%	2.2M	98.0bp	103.0bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.1%	1.1bp
UIDMSOp8A3	16.7M	16.3M	97.3%	14.1M	84.5%	2.1M	106.0bp	108.8bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIDMSOp8A4	13.3M	12.7M	96.0%	11.0M	82.5%	1.8M	102.0bp	106.2bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.1%	1.1bp
UIDMSOp8A5	16.4M	15.6M	95.6%	13.4M	81.6%	2.3M	101.0bp	106.3bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp8A6	15.7M	15.0M	95.5%	12.9M	82.0%	2.1M	103.0bp	108.5bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp10A1	10.5M	9.8M	93.7%	8.1M	77.5%	1.7M	90.0bp	97.7bp	0.9M	0.9M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp10A2	13.0M	12.3M	94.7%	10.4M	80.1%	1.9M	93.0bp	99.7bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.1bp
UIDMSOp10A3	17.7M	16.8M	95.0%	14.0M	79.2%	2.8M	91.0bp	97.8bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp10A4	20.1M	19.1M	95.2%	16.1M	79.9%	3.1M	94.0bp	99.8bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp10A5	15.6M	14.9M	95.5%	12.3M	78.8%	2.6M	95.0bp	99.3bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.5bp
UIDMSOp10A6	14.1M	13.5M	95.9%	11.2M	79.6%	2.3M	96.0bp	100.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.4bp
UIDMSOp11A1	7.6M	7.0M	91.3%	5.7M	74.3%	1.3M	79.0bp	87.0bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp11A2	6.8M	6.3M	93.0%	5.2M	76.9%	1.1M	84.0bp	90.8bp	0.5M	0.5M	0.5M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp11A3	10.9M	10.2M	93.1%	8.4M	77.2%	1.7M	83.0bp	89.9bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp11A4	9.0M	8.4M	93.8%	7.0M	78.5%	1.4M	85.0bp	90.2bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.4bp
UIDMSOp11A5	11.7M	10.9M	93.1%	9.0M	77.5%	1.8M	85.0bp	91.6bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIDMSOp11A6	10.2M	9.5M	93.2%	8.0M	78.5%	1.5M	89.0bp	95.3bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11B1	10.9M	10.2M	93.9%	8.4M	77.2%	1.8M	82.0bp	87.9bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11B2	12.0M	11.2M	93.3%	9.3M	77.5%	1.9M	84.0bp	90.9bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11B3	11.4M	10.7M	93.2%	9.0M	78.6%	1.7M	85.0bp	91.6bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11B4	13.8M	12.9M	93.7%	11.0M	79.6%	1.9M	87.0bp	93.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11B5	10.8M	10.1M	93.6%	8.5M	78.8%	1.6M	88.0bp	94.7bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11B6	11.2M	10.6M	94.6%	9.1M	81.0%	1.5M	91.0bp	95.9bp	1.0M	1.0M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11C1	14.2M	13.1M	92.5%	10.7M	75.5%	2.4M	81.0bp	87.5bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.7bp	0.0%	1.1bp
UIMCHp11C2	12.1M	11.3M	93.6%	9.6M	79.0%	1.8M	86.0bp	92.3bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11C3	10.8M	10.2M	94.0%	8.6M	79.3%	1.6M	87.0bp	92.5bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11C4	11.2M	10.6M	95.0%	8.9M	79.8%	1.7M	88.0bp	92.9bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11C5	10.9M	10.3M	94.5%	8.8M	80.2%	1.6M	87.0bp	92.3bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIMCHp11C6	12.9M	11.8M	91.8%	9.9M	77.2%	1.9M	88.0bp	95.6bp	1.1M	1.1M	1.0M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.1bp
UIfop7C1	11.4M	10.9M	96.0%	9.3M	81.8%	1.6M	100.0bp	104.6bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UIfop7C2	12.4M	12.0M	96.4%	10.2M	82.0%	1.8M	100.0bp	104.5bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	1.9bp	0.1%	1.0bp
UIfop7C3	10.7M	10.3M	95.8%	8.2M	76.4%	2.1M	98.0bp	101.5bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.9bp	0.0%	1.3bp
UIfop7C4	11.6M	11.1M	96.1%	8.7M	74.8%	2.5M	102.0bp	105.4bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.4bp
UIfop7C5	11.1M	10.5M	95.1%	9.0M	81.3%	1.5M	101.0bp	106.1bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	1.7bp	0.1%	1.0bp
UIfop7C6	13.2M	12.6M	95.4%	9.9M	75.2%	2.7M	102.0bp	105.5bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.3bp
UIfop8C1	10.8M	10.3M	95.9%	8.8M	81.8%	1.5M	101.0bp	105.3bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UIfop8C2	12.6M	12.2M	96.9%	10.4M	83.0%	1.8M	100.0bp	103.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp
UIfop8C3	15.8M	15.1M	95.8%	12.7M	80.2%	2.5M	97.0bp	102.6bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UIfop8C4	11.6M	11.1M	95.9%	9.5M	81.8%	1.6M	100.0bp	105.1bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UIfop8C5	16.6M	16.0M	96.4%	13.7M	82.8%	2.3M	102.0bp	106.6bp	1.8M	1.8M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	1.7bp	0.1%	1.0bp
UIfop8C6	13.6M	12.6M	92.4%	10.4M	76.2%	2.2M	93.0bp	101.7bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.0bp
UIprop7B2	12.0M	11.5M	96.2%	9.8M	82.0%	1.7M	99.0bp	103.7bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	1.9bp	0.1%	1.1bp
UIprop7B3	14.0M	13.5M	96.3%	10.9M	77.9%	2.6M	99.0bp	101.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.4bp
UIprop7B4	16.3M	15.7M	96.6%	13.2M	81.3%	2.5M	101.0bp	105.9bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIprop7B5	15.5M	14.9M	96.2%	12.9M	82.9%	2.1M	101.0bp	105.1bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIprop7B6	12.6M	12.1M	96.0%	10.4M	82.6%	1.7M	103.0bp	107.2bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	1.8bp	0.1%	1.1bp
UIprop8B1	10.6M	10.2M	96.3%	8.7M	82.7%	1.4M	100.0bp	104.8bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIprop8B2	10.5M	10.2M	97.1%	8.6M	81.5%	1.6M	103.0bp	106.0bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.5%	0.0%	1.8bp	0.0%	1.4bp
UIprop8B3	22.2M	21.4M	96.5%	18.3M	82.6%	3.1M	96.0bp	100.3bp	2.1M	2.1M	2.1M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIprop8B4	18.7M	18.0M	96.2%	15.0M	80.2%	3.0M	101.0bp	105.0bp	2.0M	2.0M	2.0M	0.0M	0.0M	0.0M	0.5%	0.0%	1.9bp	0.0%	1.4bp
UIprop8B5	16.5M	15.9M	96.2%	13.7M	83.0%	2.2M	103.0bp	107.7bp	1.9M	1.9M	1.8M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
UIprop8B6	15.0M	14.0M	93.8%	11.9M	79.8%	2.1M	100.0bp	107.8bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.0%	1.1bp
Uiprop7B1	10.1M	9.7M	95.5%	8.1M	80.5%	1.5M	100.0bp	105.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.6%	0.0%	1.8bp	0.1%	1.1bp

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: star_summary_table_table

Sort	Column	Description	ID	Scale
\|\|	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	Avg. read len	Average input read length	`star-avg_input_read_length`
\|\|	Avg. mapped len	Average mapped length	`star-avg_mapped_read_length`
\|\|	Splices	Number of splices: Total	`star-num_splices`	read_count
\|\|	Annotated splices	Number of splices: Annotated (sjdb)	`star-num_annotated_splices`	read_count
\|\|	GT/AG splices	Number of splices: GT/AG	`star-num_GTAG_splices`	read_count
\|\|	GC/AG splices	Number of splices: GC/AG	`star-num_GCAG_splices`	read_count
\|\|	AT/AC splices	Number of splices: AT/AC	`star-num_ATAC_splices`	read_count
\|\|	Non-canonical splices	Number of splices: Non-canonical	`star-num_noncanonical_splices`	read_count
\|\|	Mismatch rate	Mismatch rate per base	`star-mismatch_rate`
\|\|	Del rate	Deletion rate per base	`star-deletion_rate`
\|\|	Del len	Deletion average length	`star-deletion_length`
\|\|	Ins rate	Insertion rate per base	`star-insertion_rate`
\|\|	Ins len	Insertion average length	`star-insertion_length`

Alignment Scores

Created with MultiQC

UMI-tools

Tools for dealing with Unique Molecular Identifiers (UMIs)/(RMTs) and scRNA-Seq barcodes.https://github.com/CGATOxford/UMI-toolsDOI: 10.1101/gr.209601.116

Deduplicated Reads

Created with MultiQC

UMI Stats

Statistics from running umi_tools dedup or umi_tools extract

Positions Dedup: Total number of positions deduplicated
Total UMIs: Total UMIs found in sample
Unique UMIs: Unique UMIs found in sample
Mean #UMI: Mean number of unique UMIs per position
Max #UMI: Max number of unique UMIs per position

Created with MultiQC

Showing ²⁰⁴/₂₀₄ rows and ⁵/₅ columns.

Sample Name	Positions Dedup	Total UMIs	Unique UMIs	Mean #UMI	Max #UMI
UI014p1B1	1204815	13051118	5340	1.55	1454
UI014p1B2	1078538	18709070	5612	1.59	1384
UI014p1B3	1131946	12680026	5379	1.58	1687
UI014p1B4	1074447	20772242	5728	1.62	1528
UI014p1B5	1020338	19090363	5630	1.52	1142
UI014p1B6	1326796	17131823	5617	1.55	1552
UI014p2B1	996151	15325560	5480	1.51	1066
UI014p2B2	1410703	15469887	5494	1.57	1607
UI014p2B3	1629590	18727807	5682	1.60	1753
UI014p2B4	1521109	19596568	5681	1.60	1717
UI014p2B5	1339208	21503821	5859	1.58	1580
UI014p2B6	1678340	18701509	5694	1.52	1400
UI015p1C1	1212403	15886895	5542	1.57	1598
UI015p1C2	1280784	17932113	5577	1.59	1533
UI015p1C3	1306214	16906751	5604	1.61	1766
UI015p1C4	1282670	16624146	5564	1.63	1721
UI015p1C5	737849	11907088	5298	1.47	941
UI015p1C6	1262810	18487554	5664	1.56	1453
UI015p2C1	1010927	18292517	5635	1.47	606
UI015p2C2	1350131	17391791	5499	1.48	991
UI015p2C3	1281368	19359657	5680	1.58	1155
UI015p2C4	1392886	15394958	5524	1.46	1107
UI015p2C5	999668	16662065	5626	1.45	717
UI015p2C6	1252383	7871953	4829	1.44	1072
UI016p1D1	1310217	11576946	5173	1.51	1384
UI016p1D2	1182306	12016171	5269	1.53	1478
UI016p1D3	1005420	13996414	5371	1.50	1207
UI016p1D4	1282661	14512207	5455	1.54	1417
UI016p1D5	1183796	15909166	5515	1.56	1526
UI016p1D6	1212275	13117385	5417	1.52	1399
UI016p2A1	1177782	12345727	5323	1.50	1334
UI016p2A2	1142515	12285076	5310	1.49	1307
UI016p2A3	1285701	15140505	5537	1.56	1662
UI016p2A4	1578069	16051692	5489	1.60	1795
UI016p2A5	1470112	15021053	5473	1.54	1778
UI016p2A6	1417232	9582096	5025	1.46	1195
UI017p3B1	518734	12649787	5375	1.60	1143
UI017p3B2	1103021	15275669	5547	1.67	1965
UI017p3B3	855039	16757615	5617	1.60	1801
UI017p3B4	813742	18373469	5703	1.62	1550
UI017p3B5	794168	22546969	5886	1.54	1388
UI017p3B6	1207655	19043490	5751	1.60	1740
UI017p4B1	746658	11761981	5299	1.57	1472
UI017p4B2	1031839	16671141	5601	1.64	1774
UI017p4B3	1239852	22283989	5855	1.66	2099
UI017p4B4	588118	15162714	5512	1.55	1201
UI017p4B5	536437	16200763	5545	1.59	1053
UI017p4B6	1174530	17273761	5637	1.60	1734
UI018p3C1	479520	14819585	5446	1.55	986
UI018p3C2	921927	11107356	5248	1.65	1800
UI018p3C3	931431	15610628	5492	1.57	1587
UI018p3C4	1066051	16638368	5598	1.68	2022
UI018p3C5	832510	17050302	5589	1.55	1367
UI018p3C6	1068831	13753427	5401	1.59	1613
UI018p4C1	886369	13686366	5392	1.58	1478
UI018p4C2	794261	13206388	5478	1.59	1432
UI018p4C3	1313981	19221284	5790	1.63	1918
UI018p4C4	778084	14666308	5474	1.56	1440
UI018p4C5	822661	19152557	5694	1.62	1205
UI018p4C6	1288241	11435244	5213	1.57	1341
UI019p3D1	1236814	12562652	5281	1.57	1664
UI019p3D2	789867	11484326	5233	1.52	1308
UI019p3D3	755886	11727177	5312	1.53	1364
UI019p3D4	838547	12408154	5331	1.53	1540
UI019p3D5	894216	15911996	5520	1.49	1228
UI019p3D6	1208779	18507379	5653	1.54	1370
UI019p4A1	740801	11823854	5265	1.46	1121
UI019p4A2	740965	13451951	5382	1.48	1308
UI019p4A3	810684	12761667	5315	1.48	1582
UI019p4A4	784678	13521662	5429	1.52	1624
UI019p4A5	923420	14425978	5478	1.54	1783
UI019p4A6	1059599	11696717	5244	1.55	1344
UI074p5B1	1507461	8089768	4999	1.53	1618
UI074p5B2	1490288	10665420	5152	1.54	1764
UI074p5B3	1827818	12551092	5340	1.57	1971
UI074p5B4	1524841	10706227	5177	1.55	1879
UI074p5B5	1327437	11994302	5314	1.47	1212
UI074p5B6	977485	8253464	5048	1.42	948
UI074p6B1	1551675	10203577	5201	1.55	1848
UI074p6B2	1859483	11722551	5231	1.56	2032
UI074p6B3	2360377	13749966	5389	1.61	2551
UI074p6B4	2079341	14609252	5430	1.58	2379
UI074p6B5	1892743	15464639	5472	1.60	2272
UI074p6B6	1838359	12308474	5346	1.55	2198
UI075p5C1	1499646	9033288	5083	1.55	1590
UI075p5C2	1383130	10455520	5146	1.55	1638
UI075p5C3	1623324	12409549	5272	1.52	1579
UI075p5C4	1972714	18914203	5664	1.59	2204
UI075p5C5	1241714	10907724	5173	1.44	1176
UI075p5C6	1108877	10196417	5242	1.48	1190
UI075p6C1	1650187	10460433	5214	1.55	1528
UI075p6C2	1756200	12727310	5304	1.51	1887
UI075p6C3	1889583	11789038	5279	1.49	1724
UI075p6C4	2013227	14964998	5452	1.55	1902
UI075p6C5	1661690	12539917	5353	1.53	1691
UI075p6C6	1510731	17126621	5578	1.52	1423
UI076p10B1	1603788	17893033	5643	1.59	1866
UI076p10B2	1453992	13412576	5363	1.63	1940
UI076p10B3	1713710	17803544	5672	1.63	2055
UI076p10B4	1809373	20060088	5751	1.64	2207
UI076p10B5	1867019	24625253	5936	1.62	2011
UI076p10B6	1685459	21951855	5874	1.58	1821
UI076p10C1	1449739	13529150	5329	1.55	1296
UI076p10C2	1284024	14649180	5421	1.56	1242
UI076p10C3	1734179	16872555	5612	1.59	1754
UI076p10C4	1739191	17433856	5674	1.60	1643
UI076p10C5	1409445	16125521	5557	1.54	1320
UI076p10C6	1365741	15448831	5507	1.54	1119
UIDMSOp1A1	1273656	12320855	5338	1.56	1443
UIDMSOp1A2	1074930	15317747	5480	1.57	1594
UIDMSOp1A3	1217542	16523811	5526	1.54	1647
UIDMSOp1A4	1276961	15417763	5507	1.56	1661
UIDMSOp1A5	1359568	13906475	5456	1.55	1779
UIDMSOp1A6	2118887	19899116	5641	1.49	1724
UIDMSOp2A1	1169061	16013160	5489	1.50	1526
UIDMSOp2A2	1643229	16094481	5566	1.61	2072
UIDMSOp2A3	1456538	17589199	5573	1.57	1675
UIDMSOp2A4	1787858	17174750	5588	1.60	2080
UIDMSOp2A5	1571359	14940153	5550	1.55	1937
UIDMSOp2A6	1798998	16402186	5521	1.44	1452
UIDMSOp3A1	1231798	13041884	5384	1.59	1874
UIDMSOp3A2	1004254	16622887	5605	1.65	1886
UIDMSOp3A3	994215	14968025	5509	1.54	1754
UIDMSOp3A4	657077	15875991	5545	1.62	1534
UIDMSOp3A5	976546	16578237	5593	1.56	1753
UIDMSOp3A6	1124837	16729044	5620	1.56	1643
UIDMSOp4A1	1152476	14412964	5467	1.55	1747
UIDMSOp4A2	1358245	15870453	5552	1.63	2108
UIDMSOp4A3	1188323	18760008	5712	1.63	2164
UIDMSOp4A4	1066465	18968668	5666	1.64	1875
UIDMSOp4A5	1462927	19777200	5712	1.57	1971
UIDMSOp4A6	1470250	18594350	5645	1.43	1512
UIDMSOp5A1	1237800	4326559	4525	1.45	1650
UIDMSOp5A2	1604670	8304319	5022	1.53	1730
UIDMSOp5A3	1649507	9646734	5152	1.53	1724
UIDMSOp5A4	1811821	11354317	5241	1.53	2066
UIDMSOp5A5	1188699	7103068	4916	1.42	981
UIDMSOp5A6	1257550	3715603	4557	1.37	1195
UIDMSOp6A1	1697797	8295148	5009	1.52	2025
UIDMSOp6A2	1995237	11688227	5243	1.56	2036
UIDMSOp6A3	1718678	8868185	5014	1.49	1672
UIDMSOp6A4	2021318	10928022	5228	1.56	2493
UIDMSOp6A5	1509427	7844759	4931	1.48	1560
UIDMSOp6A6	2240508	8901617	5101	1.52	2404
UIDMSOp7A1	1303200	12893355	5418	1.68	2202
UIDMSOp7A2	1308792	15405375	5513	1.72	2348
UIDMSOp7A3	1322915	16822136	5553	1.69	2303
UIDMSOp7A4	1444972	22821084	5891	1.75	2403
UIDMSOp7A5	1263134	24345747	5921	1.64	2018
UIDMSOp7A6	1738985	22059373	5899	1.67	2369
UIDMSOp8A1	1430303	14551850	5469	1.67	2174
UIDMSOp8A2	1670116	18443623	5659	1.72	2417
UIDMSOp8A3	945752	20942114	5792	1.71	2029
UIDMSOp8A4	1218296	16809482	5639	1.65	2053
UIDMSOp8A5	1475840	20796448	5821	1.67	2158
UIDMSOp8A6	1413017	19607291	5731	1.61	2010
UIDMSOp10A1	1737660	14351736	5434	1.63	2111
UIDMSOp10A2	1756190	17386844	5596	1.66	2263
UIDMSOp10A3	2035948	24181837	5918	1.63	2072
UIDMSOp10A4	2387451	26788764	6020	1.68	2408
UIDMSOp10A5	1966106	21001299	5743	1.62	2193
UIDMSOp10A6	2002180	18673450	5724	1.59	2152
UIDMSOp11A1	2892979	10604901	5148	1.58	2954
UIDMSOp11A2	2704274	9230291	5082	1.54	2912
UIDMSOp11A3	3123414	14890552	5467	1.58	2839
UIDMSOp11A4	3129513	12029111	5309	1.57	2790
UIDMSOp11A5	3051845	15618600	5486	1.54	2490
UIDMSOp11A6	3118047	13242879	5415	1.60	2548
UIMCHp11B1	3365917	15184667	5429	1.63	3272
UIMCHp11B2	3120621	16427504	5521	1.58	2894
UIMCHp11B3	2854307	15281016	5454	1.55	2608
UIMCHp11B4	2912906	18129449	5648	1.55	2357
UIMCHp11B5	2498333	14229578	5402	1.52	2005
UIMCHp11B6	2595620	14535391	5473	1.55	2089
UIMCHp11C1	3802309	19926508	5652	1.63	3247
UIMCHp11C2	3064699	16289935	5550	1.58	2715
UIMCHp11C3	2649322	14480429	5462	1.55	2493
UIMCHp11C4	3249977	15102502	5523	1.58	2777
UIMCHp11C5	3116846	14545753	5447	1.56	2553
UIMCHp11C6	3209171	16574057	5569	1.61	2612
UIfop7C1	1297796	14812543	5528	1.76	2439
UIfop7C2	1314776	16054728	5552	1.76	2433
UIfop7C3	1113058	14592289	5460	1.69	2312
UIfop7C4	1000999	15592521	5522	1.72	2175
UIfop7C5	1045715	14058282	5441	1.66	2138
UIfop7C6	1238778	17522417	5573	1.67	2358
UIfop8C1	1243881	13851362	5466	1.75	2343
UIfop8C2	1575838	16362147	5587	1.76	2502
UIfop8C3	1281252	20800185	5737	1.69	2345
UIfop8C4	933683	14857307	5479	1.68	1916
UIfop8C5	966481	20966471	5790	1.74	2055
UIfop8C6	1409754	18000010	5648	1.67	2241
UIprop7B2	1229984	15474437	5547	1.68	2115
UIprop7B3	1378156	18782512	5666	1.70	2249
UIprop7B4	1513706	21025418	5807	1.72	2348
UIprop7B5	1262620	19781117	5799	1.64	1915
UIprop7B6	1049077	15835296	5556	1.60	1866
UIprop8B1	1140018	13659799	5435	1.66	1654
UIprop8B2	1439717	13672441	5443	1.68	1976
UIprop8B3	1850113	29198880	6101	1.66	2243
UIprop8B4	1374499	24422530	5908	1.68	1786
UIprop8B5	1616695	20935898	5820	1.68	1979
UIprop8B6	1347524	18893270	5677	1.52	1294
Uiprop7B1	1193442	13162291	5376	1.65	2003

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: umitools_stats_violin_table

Sort	Column	Description	ID
\|\|	Positions Dedup	Total number of positions deduplicated	`positions_deduplicated`
\|\|	Total UMIs	Total UMIs found in sample	`total_umis`
\|\|	Unique UMIs	Unique UMIs found in sample	`unique_umis`
\|\|	Mean #UMI	Mean number of unique UMIs per position	`mean_umi_per_pos`
\|\|	Max #UMI	Max number of unique UMIs per position	`max_umi_per_pos`

Sample relationships

Plots interrogating sample relationships, based on final count matrices.

STAR_SALMON DESeq2 sample similarity

is generated from clustering by Euclidean distances between DESeq2 rlog values for each sample in the deseq2_qc.r script.

Created with MultiQC

STAR_SALMON DESeq2 PCA plot

PCA plot between samples in the experiment. These values are calculated using DESeq2 in the deseq2_qc.r script.

Created with MultiQC

SortMeRNA

Program for filtering, mapping and OTU-picking NGS reads in metatranscriptomic and metagenomic data.http://bioinfo.lifl.fr/RNA/sortmernaDOI: 10.1093/bioinformatics/bts611

The core algorithm is based on approximate seeds and allows for fast and sensitive analyses of nucleotide sequences. The main application of SortMeRNA is filtering ribosomal RNA from metatranscriptomic data.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
CAT_FASTQ	cat	`9.5`
CUSTOM_GETCHROMSIZES	getchromsizes	`1.21`
CUSTOM_TX2GENE	python	`3.10.4`
DESEQ2_QC_STAR_SALMON	bioconductor-deseq2	`1.46.0`
	r-base	`4.4.2`
FASTQC_RAW	fastqc	`0.12.1`
FASTQC_TRIM	fastqc	`0.12.1`
FQ_LINT	fq	`0.12.0 (2024-07-08)`
FQ_SUBSAMPLE	fq	`0.12.0 (2024-07-08)`
GTF2BED	perl	`5.26.2`
GTF_FILTER	python	`3.9.5`
MAKE_TRANSCRIPTS_FASTA	rsem	`1.3.1`
	star	`2.7.10a`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
QUALIMAP_RNASEQ	qualimap	`2.3`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SALMON_INDEX	salmon	`1.10.3`
SALMON_QUANT	salmon	`1.10.3`
SAMTOOLS_FLAGSTAT	samtools	`1.21`
SAMTOOLS_IDXSTATS	samtools	`1.21`
SAMTOOLS_INDEX	samtools	`1.21`
SAMTOOLS_SORT	samtools	`1.21`
SAMTOOLS_SORT_QUALIMAP	samtools	`1.21`
SAMTOOLS_STATS	samtools	`1.21`
SE_GENE_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SE_TRANSCRIPT_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SORTMERNA_INDEX	sortmerna	`4.3.7`
STAR_ALIGN	gawk	`5.1.0`
	samtools	`1.21`
	star	`2.7.11b`
STAR_GENOMEGENERATE	gawk	`5.1.0`
	samtools	`1.21`
	star	`2.7.11b`
SortMeRNA	sortmerna	`4.3.7`
TXIMETA_TXIMPORT	bioconductor-tximeta	`1.20.1`
UMITOOLS_DEDUP	umitools	`1.1.5`
UMITOOLS_EXTRACT	umitools	`1.1.5`
Workflow	Nextflow	`25.04.7`
	nf-core/rnaseq	`v3.22.2-g3816d48`
fastp	fastp	`0.24.0`

nf-core/rnaseq Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.https://github.com/nf-core/rnaseq

Methods

Data was processed using nf-core/rnaseq v3.22.2 (doi: 10.5281/zenodo.1400710) of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.04.7 (Di Tommaso et al., 2017) with the following command:

nextflow run nf-core/rnaseq -r 3.22.2 -c ../rnaseq.config -params-file ../params_rnaseq.json -resume -profile crg_slurm

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnaseq Workflow Summary

this information is collected when the pipeline is started.https://github.com/nf-core/rnaseq

Input/output options

input: ../samplesheet_H295R.csv
multiqc_title: PTox-WP6-H295R
outdir: ./rnaseq_output

Reference genome options

fasta: ../refs/Human/genome_with_spikes.fa
gtf: ../refs/Human/genome_annotation_with_spikes.gtf
gtf_extra_attributes: gene

Read trimming options

extra_fastp_args: --length_required=20 --trim_poly_g --poly_g_min_len=20 --trim_poly_x --poly_x_min_len=15 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --dont_eval_duplication --cut_tail
trimmer: fastp

Read filtering options

remove_ribo_rna: true

UMI options

umi_discard_read: 0
umitools_bc_pattern: ^(?P.{6})(?P.{4}).*
umitools_dedup_stats: true
umitools_extract_method: regex
with_umi: true

Alignment options

extra_salmon_quant_args: --noLengthCorrection
extra_star_align_args: --alignIntronMax 1000000 --alignIntronMin 20 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --outFilterMismatchNmax 999 --outFilterMultimapNmax 20 --outFilterType BySJout --outFilterMismatchNoverLmax 0.1 --clip3pAdapterSeq AAAAAAAA
stranded_threshold: 0.7

Optional outputs

save_reference: true

Process skipping options

skip_bigwig: true
skip_biotype_qc: true
skip_dupradar: true
skip_preseq: false
skip_pseudo_alignment: true
skip_stringtie: true

Generic options

monochrome_logs: true
trace_report_suffix: 2026-06-06_10-15-46

Core Nextflow options

configFiles: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq/nextflow.config, /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-H295R/../rnaseq.config
containerEngine: apptainer
launchDir: /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-H295R
profile: crg_slurm
projectDir: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq
revision: 3.22.2
runName: astonishing_wegener
userName: vntasis
workDir: /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-H295R/work

PTox-WP6-H295R

MultiQC Toolbox

Apply Highlight Samples

Rename Samples Bulk input Apply

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots All None

Save Settings

Load Settings

Tool Citations

About MultiQC

PTox-WP6-H295R

Report AI Summary

General Statistics

AI Summary

General Statistics: Columns

Sample status checks

Strandedness Checks

AI Summary

Samples strandedness check: Columns

FastQC (raw)

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Overrepresented sequences by sample Help

AI Summary

Top overrepresented sequences

AI Summary

FastQC: Top overrepresented sequences: Columns

AI Summary

Status Checks Help

AI Summary

fastp

Filtered Reads

AI Summary

Sequence Quality

AI Summary

GC Content

AI Summary

N content

AI Summary

FastQC (trimmed)

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Overrepresented sequences by sample Help

AI Summary

Top overrepresented sequences

AI Summary

FastQC: Top overrepresented sequences: Columns

AI Summary

Status Checks Help

AI Summary

Preseq

Complexity curve (molecule count)

AI Summary

QualiMap

Genomic origin of reads Help

AI Summary

Gene Coverage Profile Help

AI Summary

RSeQC

Read Distribution

Highlight Samples

Rename Samples

Show / Hide Samples

Choose Plots

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks

Genomic origin of reads

Gene Coverage Profile

Percent mapped

UMI Stats