PTox-WP6-Danio-without-deduplication: MultiQC Report

General Statistics

Showing ¹⁹²/₁₉₂ rows and ¹⁰/₁₉ columns.

Sample Name	dupInt	Duplication	5'-3' bias	M Aligned	Exonic	Intronic	Intergenic	Overlapping Exon	Error rate	Non-primary	Reads mapped	% Mapped	% Proper pairs	% MapQ 0 reads	Total seqs	Mean insert	Reads	Reads mapped	% Reads mapped
RZY000ZA1	1.9	92.8%	0.65	17.6M	11.8M	3.4M	1.1M	1.0M	0.76%	5.4M	17.6M	100.0%	0.0%	2.5%	17.6M	0.0bp	23.0M	23.0M	100.0%
RZY000ZA2	1.1	85.9%	0.58	7.9M	5.1M	1.6M	0.5M	0.4M	0.77%	3.3M	7.9M	100.0%	0.0%	3.4%	7.9M	0.0bp	11.2M	11.2M	100.0%
RZY000ZA3	1.3	87.2%	0.84	8.9M	5.7M	1.7M	0.5M	0.5M	0.77%	3.5M	8.9M	100.0%	0.0%	3.2%	8.9M	0.0bp	12.4M	12.4M	100.0%
RZY000ZA4	1.1	86.5%	0.62	10.8M	7.1M	2.0M	0.6M	0.6M	0.76%	3.8M	10.8M	100.0%	0.0%	2.9%	10.8M	0.0bp	14.6M	14.6M	100.0%
RZY000ZA5	0.9	83.9%	0.76	8.9M	5.8M	1.7M	0.5M	0.5M	0.76%	2.7M	8.9M	100.0%	0.0%	2.5%	8.9M	0.0bp	11.6M	11.6M	100.0%
RZY000ZA6	1.1	86.2%	0.79	8.8M	5.8M	1.6M	0.5M	0.5M	0.74%	3.0M	8.8M	100.0%	0.0%	2.9%	8.8M	0.0bp	11.8M	11.8M	100.0%
RZY019HA1	0.8	82.3%	0.58	8.2M	5.3M	1.6M	0.5M	0.4M	0.77%	3.4M	8.2M	100.0%	0.0%	3.3%	8.2M	0.0bp	11.6M	11.6M	100.0%
RZY019HA2	0.8	82.7%	0.70	7.6M	5.0M	1.4M	0.5M	0.4M	0.79%	2.9M	7.6M	100.0%	0.0%	3.1%	7.6M	0.0bp	10.6M	10.6M	100.0%
RZY019HA3	1.2	87.1%	0.73	10.6M	6.8M	2.1M	0.6M	0.6M	0.77%	3.9M	10.6M	100.0%	0.0%	2.9%	10.6M	0.0bp	14.5M	14.5M	100.0%
RZY019HA4	1.0	85.0%	0.63	11.7M	7.5M	2.4M	0.7M	0.7M	0.78%	3.6M	11.7M	100.0%	0.0%	2.5%	11.7M	0.0bp	15.3M	15.3M	100.0%
RZY019HA5	1.0	85.6%	0.76	9.6M	6.3M	1.9M	0.6M	0.5M	0.75%	2.9M	9.6M	100.0%	0.0%	2.5%	9.6M	0.0bp	12.5M	12.5M	100.0%
RZY019HA6	1.1	86.3%	0.72	10.1M	6.6M	2.0M	0.6M	0.6M	0.77%	3.1M	10.1M	100.0%	0.0%	2.6%	10.1M	0.0bp	13.3M	13.3M	100.0%
RZY019LA1	1.2	88.4%	0.58	8.2M	5.5M	1.4M	0.4M	0.4M	0.73%	3.3M	8.2M	100.0%	0.0%	3.2%	8.2M	0.0bp	11.5M	11.5M	100.0%
RZY019LA2	1.2	88.1%	0.64	13.8M	8.7M	2.8M	0.8M	0.7M	0.79%	5.4M	13.8M	100.0%	0.0%	3.2%	13.8M	0.0bp	19.2M	19.2M	100.0%
RZY019LA3	1.2	86.9%	0.74	11.8M	7.7M	2.3M	0.7M	0.6M	0.79%	4.2M	11.8M	100.0%	0.0%	3.0%	11.8M	0.0bp	16.0M	16.0M	100.0%
RZY019LA4	1.2	87.6%	0.69	11.2M	7.3M	2.2M	0.6M	0.6M	0.78%	3.9M	11.2M	100.0%	0.0%	3.0%	11.2M	0.0bp	15.1M	15.1M	100.0%
RZY019LA5	1.2	87.8%	0.82	11.5M	7.6M	2.2M	0.7M	0.7M	0.75%	3.5M	11.5M	100.0%	0.0%	2.5%	11.5M	0.0bp	15.0M	15.0M	100.0%
RZY019LA6	1.0	85.8%	0.83	9.8M	6.5M	1.9M	0.5M	0.6M	0.74%	2.8M	9.8M	100.0%	0.0%	2.4%	9.8M	0.0bp	12.6M	12.6M	100.0%
RZY996LA1	1.9	93.0%	0.80	20.8M	13.4M	4.0M	1.3M	1.2M	0.76%	7.7M	20.8M	100.0%	0.0%	2.9%	20.8M	0.0bp	28.5M	28.5M	100.0%
RZY996LA2	1.5	89.3%	0.54	9.1M	5.9M	1.7M	0.5M	0.5M	0.75%	3.4M	9.1M	100.0%	0.0%	3.0%	9.1M	0.0bp	12.5M	12.5M	100.0%
RZY996LA3	0.9	84.3%	0.51	8.5M	5.7M	1.6M	0.5M	0.4M	0.77%	2.9M	8.5M	100.0%	0.0%	2.9%	8.5M	0.0bp	11.4M	11.4M	100.0%
RZY996LA4	1.1	86.1%	0.71	9.0M	5.8M	1.7M	0.5M	0.5M	0.76%	3.8M	9.0M	100.0%	0.0%	3.5%	9.0M	0.0bp	12.8M	12.8M	100.0%
RZY996LA5	1.1	87.4%	0.83	10.7M	7.2M	2.0M	0.6M	0.6M	0.75%	3.3M	10.7M	100.0%	0.0%	2.4%	10.7M	0.0bp	14.0M	14.0M	100.0%
RZY996LA6	1.1	86.8%	0.78	10.3M	6.8M	2.0M	0.6M	0.5M	0.76%	3.5M	10.3M	100.0%	0.0%	2.9%	10.3M	0.0bp	13.8M	13.8M	100.0%
RZY996MA1	1.6	92.1%	0.51	12.6M	7.8M	2.5M	0.8M	0.6M	0.76%	6.0M	12.6M	100.0%	0.0%	4.0%	12.6M	0.0bp	18.6M	18.6M	100.0%
RZY996MA2	1.0	85.6%	0.73	9.6M	6.4M	1.9M	0.6M	0.5M	0.79%	3.1M	9.6M	100.0%	0.0%	2.8%	9.6M	0.0bp	12.7M	12.7M	100.0%
RZY996MA3	1.0	86.0%	0.68	9.3M	6.3M	1.8M	0.5M	0.5M	0.76%	3.1M	9.3M	100.0%	0.0%	2.7%	9.3M	0.0bp	12.4M	12.4M	100.0%
RZY996MA4	1.0	85.5%	0.65	9.6M	6.4M	1.9M	0.5M	0.5M	0.75%	3.4M	9.6M	100.0%	0.0%	3.0%	9.6M	0.0bp	13.0M	13.0M	100.0%
RZY996MA5	1.0	86.0%	0.71	8.9M	5.9M	1.6M	0.5M	0.4M	0.76%	3.0M	8.9M	100.0%	0.0%	2.8%	8.9M	0.0bp	11.9M	11.9M	100.0%
RZY996MA6	1.1	87.1%	0.95	9.2M	6.2M	1.7M	0.5M	0.5M	0.75%	2.8M	9.2M	100.0%	0.0%	2.4%	9.2M	0.0bp	12.0M	12.0M	100.0%
RZY999ZA1	1.8	92.9%	0.74	22.0M	13.9M	4.3M	1.3M	1.2M	0.77%	9.5M	22.0M	100.0%	0.0%	3.4%	22.0M	0.0bp	31.4M	31.4M	100.0%
RZY999ZA2	1.1	84.7%	0.56	6.3M	4.1M	1.3M	0.4M	0.4M	0.77%	2.2M	6.3M	100.0%	0.0%	2.9%	6.3M	0.0bp	8.5M	8.5M	100.0%
RZY999ZA3	1.1	86.4%	0.68	10.0M	6.5M	1.9M	0.6M	0.5M	0.76%	3.8M	10.0M	100.0%	0.0%	2.9%	10.0M	0.0bp	13.8M	13.8M	100.0%
RZY999ZA4	1.2	87.1%	0.84	10.0M	6.3M	2.0M	0.6M	0.5M	0.78%	4.0M	10.0M	100.0%	0.0%	3.3%	10.0M	0.0bp	14.0M	14.0M	100.0%
RZY999ZA5	1.0	85.0%	0.80	8.8M	5.7M	1.7M	0.5M	0.5M	0.77%	3.0M	8.8M	100.0%	0.0%	2.6%	8.8M	0.0bp	11.8M	11.8M	100.0%
RZY999ZA6	1.2	87.0%	0.80	9.5M	6.2M	1.8M	0.6M	0.5M	0.76%	3.0M	9.5M	100.0%	0.0%	2.6%	9.5M	0.0bp	12.4M	12.4M	100.0%
RZZ000ZA1	1.3	88.3%	0.77	11.2M	7.6M	2.1M	0.6M	0.7M	0.80%	2.7M	11.2M	100.0%	0.0%	1.9%	11.2M	0.0bp	13.9M	13.9M	100.0%
RZZ000ZA2	2.0	92.1%	1.35	7.9M	5.5M	1.6M	0.4M	0.4M	0.83%	1.2M	7.9M	100.0%	0.0%	1.3%	7.9M	0.0bp	9.1M	9.1M	100.0%
RZZ000ZA3	1.2	88.2%	0.73	13.5M	9.3M	2.6M	0.7M	0.8M	0.81%	2.9M	13.5M	100.0%	0.0%	1.7%	13.5M	0.0bp	16.4M	16.4M	100.0%
RZZ000ZA4	1.3	88.0%	0.78	17.2M	10.7M	4.1M	1.1M	0.8M	0.86%	3.5M	17.2M	100.0%	0.0%	1.7%	17.2M	0.0bp	20.7M	20.7M	100.0%
RZZ000ZA5	1.1	88.5%	0.87	20.2M	13.7M	4.1M	1.1M	1.3M	0.80%	3.6M	20.2M	100.0%	0.0%	1.4%	20.2M	0.0bp	23.9M	23.9M	100.0%
RZZ000ZA6	1.4	89.3%	0.96	14.0M	9.2M	2.8M	0.8M	0.7M	0.80%	3.7M	14.0M	100.0%	0.0%	2.2%	14.0M	0.0bp	17.7M	17.7M	100.0%
RZZ014HA1	1.4	89.7%	0.66	12.2M	8.4M	2.3M	0.6M	0.7M	0.80%	2.6M	12.2M	100.0%	0.0%	1.6%	12.2M	0.0bp	14.8M	14.8M	100.0%
RZZ014HA2	1.2	89.9%	0.78	14.5M	10.5M	2.5M	0.8M	0.8M	0.77%	2.2M	14.5M	100.0%	0.0%	1.3%	14.5M	0.0bp	16.8M	16.8M	100.0%
RZZ014HA3	0.8	85.1%	0.79	12.1M	8.1M	2.2M	0.7M	0.6M	0.80%	3.5M	12.1M	100.0%	0.0%	2.3%	12.1M	0.0bp	15.6M	15.6M	100.0%
RZZ014HA4	1.3	89.9%	0.74	16.1M	10.9M	2.8M	0.9M	0.9M	0.77%	3.7M	16.1M	100.0%	0.0%	1.7%	16.1M	0.0bp	19.8M	19.8M	100.0%
RZZ014HA5	1.3	89.6%	0.88	14.0M	9.9M	2.5M	0.7M	0.8M	0.79%	2.5M	14.0M	100.0%	0.0%	1.4%	14.0M	0.0bp	16.5M	16.5M	100.0%
RZZ014HA6	1.1	88.4%	0.69	15.5M	10.5M	2.6M	0.9M	0.9M	0.74%	3.8M	15.5M	100.0%	0.0%	1.8%	15.5M	0.0bp	19.3M	19.3M	100.0%
RZZ014LA1	1.2	87.7%	0.86	14.2M	9.3M	2.9M	0.8M	0.8M	0.83%	3.6M	14.2M	100.0%	0.0%	2.0%	14.2M	0.0bp	17.9M	17.9M	100.0%
RZZ014LA2	1.3	89.5%	0.73	15.2M	10.5M	2.9M	0.8M	0.9M	0.77%	2.7M	15.2M	100.0%	0.0%	1.4%	15.2M	0.0bp	17.9M	17.9M	100.0%
RZZ014LA3	1.4	89.5%	0.91	14.5M	10.0M	2.7M	0.8M	0.8M	0.80%	3.4M	14.5M	100.0%	0.0%	1.8%	14.5M	0.0bp	17.9M	17.9M	100.0%
RZZ014LA4	1.3	89.0%	0.87	13.1M	8.8M	2.5M	0.7M	0.8M	0.77%	3.1M	13.1M	100.0%	0.0%	1.8%	13.1M	0.0bp	16.3M	16.3M	100.0%
RZZ014LA5	1.0	86.6%	0.68	15.2M	10.5M	3.0M	0.9M	1.1M	0.80%	2.4M	15.2M	100.0%	0.0%	1.3%	15.2M	0.0bp	17.6M	17.6M	100.0%
RZZ014LA6	1.0	87.4%	0.64	11.3M	7.7M	2.1M	0.6M	0.9M	0.75%	1.8M	11.3M	100.0%	0.0%	1.1%	11.3M	0.0bp	13.1M	13.1M	100.0%
RZZ015HA1	1.2	88.1%	0.87	14.2M	9.9M	2.5M	0.8M	0.8M	0.81%	3.1M	14.2M	100.0%	0.0%	1.7%	14.2M	0.0bp	17.4M	17.4M	100.0%
RZZ015HA2	0.9	85.7%	0.85	10.8M	7.6M	1.9M	0.6M	0.6M	0.79%	2.1M	10.8M	100.0%	0.0%	1.5%	10.8M	0.0bp	12.9M	12.9M	100.0%
RZZ015HA3	1.0	87.0%	0.79	15.3M	10.4M	2.9M	0.9M	0.9M	0.83%	3.2M	15.3M	100.0%	0.0%	1.6%	15.3M	0.0bp	18.6M	18.6M	100.0%
RZZ015HA4	1.3	89.4%	0.83	13.2M	9.1M	2.3M	0.7M	0.8M	0.77%	3.1M	13.2M	100.0%	0.0%	1.7%	13.2M	0.0bp	16.3M	16.3M	100.0%
RZZ015HA5	1.3	89.9%	0.70	17.9M	12.2M	3.3M	1.0M	1.0M	0.79%	3.7M	17.9M	100.0%	0.0%	1.5%	17.9M	0.0bp	21.6M	21.6M	100.0%
RZZ015HA6	1.5	90.5%	1.30	14.4M	10.0M	2.5M	0.8M	0.7M	0.79%	4.1M	14.4M	100.0%	0.0%	2.4%	14.4M	0.0bp	18.5M	18.5M	100.0%
RZZ015LA1	1.0	85.8%	0.82	13.7M	8.9M	2.9M	0.8M	0.8M	0.85%	3.2M	13.7M	100.0%	0.0%	1.9%	13.7M	0.0bp	17.0M	17.0M	100.0%
RZZ015LA2	0.9	86.2%	0.76	14.6M	10.2M	2.7M	0.8M	0.9M	0.78%	2.3M	14.6M	100.0%	0.0%	1.3%	14.6M	0.0bp	16.9M	16.9M	100.0%
RZZ015LA3	1.5	89.4%	0.94	12.2M	8.3M	2.3M	0.7M	0.7M	0.82%	2.8M	12.2M	100.0%	0.0%	1.8%	12.2M	0.0bp	15.0M	15.0M	100.0%
RZZ015LA4	1.2	88.5%	0.77	14.1M	9.3M	2.7M	0.8M	0.8M	0.78%	3.6M	14.1M	100.0%	0.0%	1.9%	14.1M	0.0bp	17.7M	17.7M	100.0%
RZZ015LA5	1.0	87.0%	0.93	16.5M	11.0M	3.3M	0.9M	1.0M	0.80%	4.2M	16.5M	100.0%	0.0%	2.1%	16.5M	0.0bp	20.7M	20.7M	100.0%
RZZ015LA6	1.3	89.3%	0.74	15.3M	10.5M	2.8M	0.8M	0.9M	0.77%	3.6M	15.3M	100.0%	0.0%	1.8%	15.3M	0.0bp	18.9M	18.9M	100.0%
RZZ016HA1	1.4	89.8%	0.67	14.6M	10.0M	2.8M	0.8M	0.9M	0.81%	3.1M	14.6M	100.0%	0.0%	1.7%	14.6M	0.0bp	17.8M	17.8M	100.0%
RZZ016HA2	1.3	89.6%	0.84	16.2M	11.3M	2.9M	0.9M	0.8M	0.77%	3.5M	16.2M	100.0%	0.0%	1.7%	16.2M	0.0bp	19.6M	19.6M	100.0%
RZZ016HA3	1.4	89.9%	0.67	15.0M	10.2M	2.8M	0.9M	0.8M	0.81%	3.6M	15.0M	100.0%	0.0%	1.9%	15.0M	0.0bp	18.6M	18.6M	100.0%
RZZ016HA4	1.2	89.1%	1.02	13.0M	9.0M	2.2M	0.7M	0.7M	0.76%	3.4M	13.0M	100.0%	0.0%	2.0%	13.0M	0.0bp	16.4M	16.4M	100.0%
RZZ016HA5	0.9	85.8%	0.92	13.0M	8.5M	2.5M	0.7M	0.6M	0.81%	5.0M	13.0M	100.0%	0.0%	3.1%	13.0M	0.0bp	18.0M	18.0M	100.0%
RZZ016HA6	1.5	91.3%	0.83	11.9M	8.3M	1.9M	0.6M	0.6M	0.75%	3.0M	11.9M	100.0%	0.0%	1.8%	11.9M	0.0bp	14.9M	14.9M	100.0%
RZZ016LA1	0.8	83.2%	0.77	11.9M	7.5M	2.6M	0.7M	0.6M	0.85%	3.6M	11.9M	100.0%	0.0%	2.5%	11.9M	0.0bp	15.5M	15.5M	100.0%
RZZ016LA2	1.0	86.2%	0.79	12.4M	8.6M	2.4M	0.7M	0.7M	0.79%	2.1M	12.4M	100.0%	0.0%	1.3%	12.4M	0.0bp	14.5M	14.5M	100.0%
RZZ016LA3	1.3	89.0%	0.88	16.0M	10.6M	3.2M	0.9M	0.9M	0.82%	3.7M	16.0M	100.0%	0.0%	1.8%	16.0M	0.0bp	19.8M	19.8M	100.0%
RZZ016LA4	1.1	88.0%	0.67	15.8M	11.0M	2.9M	0.9M	1.0M	0.76%	3.4M	15.8M	100.0%	0.0%	1.8%	15.8M	0.0bp	19.2M	19.2M	100.0%
RZZ016LA5	1.2	88.7%	0.77	13.6M	9.6M	2.5M	0.7M	0.9M	0.79%	2.5M	13.6M	100.0%	0.0%	1.5%	13.6M	0.0bp	16.2M	16.2M	100.0%
RZZ016LA6	1.1	88.0%	0.81	13.4M	9.2M	2.4M	0.8M	0.8M	0.78%	2.7M	13.4M	100.0%	0.0%	1.5%	13.4M	0.0bp	16.1M	16.1M	100.0%
RZZ017HA1	1.5	90.3%	0.74	13.8M	9.5M	2.4M	0.7M	0.8M	0.82%	3.4M	13.8M	100.0%	0.0%	1.9%	13.8M	0.0bp	17.2M	17.2M	100.0%
RZZ017HA2	1.5	91.1%	0.88	18.0M	12.4M	3.2M	1.0M	0.9M	0.78%	4.3M	18.0M	100.0%	0.0%	1.9%	18.0M	0.0bp	22.2M	22.2M	100.0%
RZZ017HA3	1.4	90.3%	0.75	14.7M	9.8M	2.5M	0.8M	0.8M	0.80%	4.1M	14.7M	100.0%	0.0%	2.0%	14.7M	0.0bp	18.8M	18.8M	100.0%
RZZ017HA4	1.0	86.6%	0.80	14.1M	9.4M	2.6M	0.8M	0.7M	0.80%	4.0M	14.1M	100.0%	0.0%	2.2%	14.1M	0.0bp	18.1M	18.1M	100.0%
RZZ017HA5	1.6	90.2%	0.82	12.7M	9.0M	2.2M	0.7M	0.8M	0.82%	2.5M	12.7M	100.0%	0.0%	1.5%	12.7M	0.0bp	15.2M	15.2M	100.0%
RZZ017HA6	1.7	91.8%	0.67	13.0M	9.1M	2.0M	0.7M	0.7M	0.75%	3.2M	13.0M	100.0%	0.0%	1.7%	13.0M	0.0bp	16.2M	16.2M	100.0%
RZZ017LA1	1.3	88.3%	0.88	13.5M	8.9M	2.7M	0.8M	0.8M	0.82%	3.4M	13.5M	100.0%	0.0%	2.0%	13.5M	0.0bp	17.0M	17.0M	100.0%
RZZ017LA2	1.1	88.2%	0.77	13.4M	9.3M	2.5M	0.7M	0.8M	0.78%	2.4M	13.4M	100.0%	0.0%	1.4%	13.4M	0.0bp	15.8M	15.8M	100.0%
RZZ017LA3	1.2	88.6%	0.90	14.0M	9.6M	2.6M	0.7M	0.8M	0.79%	3.2M	14.0M	100.0%	0.0%	1.8%	14.0M	0.0bp	17.2M	17.2M	100.0%
RZZ017LA4	1.1	87.2%	0.91	12.1M	8.3M	2.4M	0.7M	0.7M	0.78%	2.7M	12.1M	100.0%	0.0%	1.8%	12.1M	0.0bp	14.8M	14.8M	100.0%
RZZ017LA5	1.2	88.3%	0.73	13.6M	9.5M	2.6M	0.8M	0.9M	0.80%	2.4M	13.6M	100.0%	0.0%	1.4%	13.6M	0.0bp	16.0M	16.0M	100.0%
RZZ017LA6	1.3	91.1%	0.79	14.3M	9.9M	2.9M	0.8M	1.1M	0.79%	1.8M	14.3M	100.0%	0.0%	0.9%	14.3M	0.0bp	16.1M	16.1M	100.0%
RZZ018HA1	1.1	86.3%	0.62	12.2M	8.1M	2.3M	0.7M	0.7M	0.81%	3.4M	12.2M	100.0%	0.0%	2.2%	12.2M	0.0bp	15.6M	15.6M	100.0%
RZZ018HA2	1.0	87.1%	0.61	14.3M	9.9M	2.7M	0.8M	0.8M	0.78%	2.7M	14.3M	100.0%	0.0%	1.5%	14.3M	0.0bp	16.9M	16.9M	100.0%
RZZ018HA3	1.3	88.9%	0.72	17.3M	11.6M	3.4M	1.0M	1.0M	0.83%	3.9M	17.3M	100.0%	0.0%	1.8%	17.3M	0.0bp	21.2M	21.2M	100.0%
RZZ018HA4	1.1	87.0%	0.53	15.0M	9.8M	3.2M	0.9M	0.8M	0.82%	3.1M	15.0M	100.0%	0.0%	1.7%	15.0M	0.0bp	18.2M	18.2M	100.0%
RZZ018HA5	0.8	83.9%	0.64	11.8M	7.8M	2.4M	0.7M	0.7M	0.82%	3.1M	11.8M	100.0%	0.0%	2.0%	11.8M	0.0bp	14.9M	14.9M	100.0%
RZZ018HA6	1.4	90.4%	0.58	17.1M	11.7M	3.2M	1.0M	1.0M	0.78%	3.7M	17.1M	100.0%	0.0%	1.6%	17.1M	0.0bp	20.8M	20.8M	100.0%
RZZ018LA1	1.4	88.8%	0.88	12.0M	8.2M	2.4M	0.6M	0.8M	0.81%	2.4M	12.0M	100.0%	0.0%	1.6%	12.0M	0.0bp	14.4M	14.4M	100.0%
RZZ018LA2	0.9	87.0%	0.76	18.5M	12.7M	3.4M	1.1M	1.0M	0.78%	5.1M	18.5M	100.0%	0.0%	2.3%	18.5M	0.0bp	23.6M	23.6M	100.0%
RZZ018LA3	1.6	90.3%	0.89	11.7M	8.0M	2.2M	0.6M	0.7M	0.79%	2.7M	11.7M	100.0%	0.0%	1.8%	11.7M	0.0bp	14.4M	14.4M	100.0%
RZZ018LA4	1.4	89.7%	0.73	15.0M	9.9M	2.9M	0.8M	0.8M	0.78%	3.8M	15.0M	100.0%	0.0%	1.9%	15.0M	0.0bp	18.8M	18.8M	100.0%
RZZ018LA5	1.1	86.4%	0.82	11.7M	8.1M	2.2M	0.7M	0.7M	0.81%	2.2M	11.7M	100.0%	0.0%	1.5%	11.7M	0.0bp	13.9M	13.9M	100.0%
RZZ018LA6	1.4	89.6%	0.72	16.0M	10.9M	3.0M	0.9M	0.9M	0.79%	3.6M	16.0M	100.0%	0.0%	1.7%	16.0M	0.0bp	19.6M	19.6M	100.0%
RZZ019HA1	1.4	88.1%	0.58	10.3M	6.8M	2.0M	0.6M	0.7M	0.81%	2.6M	10.3M	100.0%	0.0%	1.9%	10.3M	0.0bp	12.9M	12.9M	100.0%
RZZ019HA2	1.2	88.5%	0.79	11.5M	8.1M	2.0M	0.6M	0.7M	0.77%	2.3M	11.5M	100.0%	0.0%	1.6%	11.5M	0.0bp	13.8M	13.8M	100.0%
RZZ019HA3	0.8	83.2%	0.81	12.8M	8.4M	2.6M	0.8M	0.7M	0.83%	3.3M	12.8M	100.0%	0.0%	2.0%	12.8M	0.0bp	16.1M	16.1M	100.0%
RZZ019HA4	1.5	90.2%	0.81	13.7M	9.3M	2.5M	0.7M	0.8M	0.75%	3.3M	13.7M	100.0%	0.0%	1.8%	13.7M	0.0bp	17.0M	17.0M	100.0%
RZZ019HA5	1.2	87.1%	0.58	8.1M	5.4M	1.6M	0.5M	0.5M	0.81%	2.0M	8.1M	100.0%	0.0%	1.9%	8.1M	0.0bp	10.1M	10.1M	100.0%
RZZ019HA6	1.0	87.5%	0.68	12.6M	8.3M	2.2M	0.7M	0.7M	0.76%	3.4M	12.6M	100.0%	0.0%	1.9%	12.6M	0.0bp	16.0M	16.0M	100.0%
RZZ019LA1	0.9	83.7%	0.98	10.6M	6.7M	2.3M	0.6M	0.6M	0.83%	3.5M	10.6M	100.0%	0.0%	2.7%	10.6M	0.0bp	14.1M	14.1M	100.0%
RZZ019LA2	0.7	82.3%	0.85	7.2M	4.9M	1.3M	0.4M	0.4M	0.77%	1.5M	7.2M	100.0%	0.0%	1.5%	7.2M	0.0bp	8.6M	8.6M	100.0%
RZZ019LA3	1.0	85.2%	0.81	12.6M	8.3M	2.6M	0.7M	0.7M	0.84%	3.2M	12.6M	100.0%	0.0%	2.0%	12.6M	0.0bp	15.8M	15.8M	100.0%
RZZ019LA4	1.3	89.2%	0.94	17.6M	11.8M	3.4M	1.0M	1.0M	0.79%	4.1M	17.6M	100.0%	0.0%	1.8%	17.6M	0.0bp	21.7M	21.7M	100.0%
RZZ019LA5	1.2	88.3%	0.82	17.8M	12.0M	3.6M	1.0M	1.2M	0.80%	3.1M	17.8M	100.0%	0.0%	1.4%	17.8M	0.0bp	20.9M	20.9M	100.0%
RZZ019LA6	0.8	82.9%	0.70	9.1M	6.1M	1.7M	0.5M	0.5M	0.78%	1.9M	9.1M	100.0%	0.0%	1.6%	9.1M	0.0bp	11.0M	11.0M	100.0%
RZZ035HA1	1.3	88.6%	0.96	14.2M	9.5M	2.7M	0.8M	0.8M	0.79%	3.5M	14.2M	100.0%	0.0%	1.9%	14.2M	0.0bp	17.6M	17.6M	100.0%
RZZ035HA2	0.9	85.2%	0.64	12.0M	7.9M	2.1M	0.7M	0.7M	0.77%	3.2M	12.0M	100.0%	0.0%	1.9%	12.0M	0.0bp	15.1M	15.1M	100.0%
RZZ035HA3	1.0	87.0%	0.68	13.3M	9.0M	2.6M	0.7M	0.8M	0.80%	3.2M	13.3M	100.0%	0.0%	1.9%	13.3M	0.0bp	16.6M	16.6M	100.0%
RZZ035HA4	1.9	91.8%	0.88	10.6M	7.1M	2.1M	0.6M	0.6M	0.78%	2.6M	10.6M	100.0%	0.0%	1.9%	10.6M	0.0bp	13.2M	13.2M	100.0%
RZZ035HA5	1.3	89.2%	0.75	16.0M	10.6M	3.1M	0.9M	1.0M	0.79%	3.2M	16.0M	100.0%	0.0%	1.4%	16.0M	0.0bp	19.1M	19.1M	100.0%
RZZ035HA6	1.1	87.4%	0.78	12.6M	8.6M	2.4M	0.7M	0.7M	0.78%	2.8M	12.6M	100.0%	0.0%	1.7%	12.6M	0.0bp	15.5M	15.5M	100.0%
RZZ035LA1	1.2	87.5%	0.77	12.2M	8.2M	2.4M	0.7M	0.7M	0.82%	2.8M	12.2M	100.0%	0.0%	1.8%	12.2M	0.0bp	15.0M	15.0M	100.0%
RZZ035LA2	0.8	83.3%	0.63	8.5M	5.9M	1.6M	0.4M	0.5M	0.79%	1.4M	8.5M	100.0%	0.0%	1.3%	8.5M	0.0bp	9.9M	9.9M	100.0%
RZZ035LA3	1.7	91.5%	0.81	17.0M	11.8M	3.0M	0.9M	1.0M	0.80%	3.8M	17.0M	100.0%	0.0%	1.7%	17.0M	0.0bp	20.7M	20.7M	100.0%
RZZ035LA4	1.2	87.6%	0.66	13.0M	8.6M	2.5M	0.7M	0.7M	0.79%	3.2M	13.0M	100.0%	0.0%	1.9%	13.0M	0.0bp	16.2M	16.2M	100.0%
RZZ035LA5	0.8	84.1%	0.86	14.3M	9.7M	2.8M	0.8M	0.9M	0.81%	3.0M	14.3M	100.0%	0.0%	1.8%	14.3M	0.0bp	17.3M	17.3M	100.0%
RZZ035LA6	0.8	85.0%	0.66	10.5M	7.3M	2.0M	0.5M	0.6M	0.76%	2.3M	10.5M	100.0%	0.0%	1.7%	10.5M	0.0bp	12.8M	12.8M	100.0%
RZZ074HA1	1.1	87.2%	0.64	12.7M	8.5M	2.4M	0.7M	0.8M	0.81%	3.2M	12.7M	100.0%	0.0%	2.0%	12.7M	0.0bp	15.8M	15.8M	100.0%
RZZ074HA2	1.0	87.2%	0.75	15.1M	10.0M	2.9M	0.9M	0.8M	0.80%	4.1M	15.1M	100.0%	0.0%	2.1%	15.1M	0.0bp	19.2M	19.2M	100.0%
RZZ074HA3	1.8	90.9%	0.70	9.6M	6.4M	1.8M	0.6M	0.6M	0.82%	2.8M	9.6M	100.0%	0.0%	2.4%	9.6M	0.0bp	12.4M	12.4M	100.0%
RZZ074HA4	1.4	89.9%	0.71	15.3M	10.4M	2.9M	0.8M	0.8M	0.76%	3.7M	15.3M	100.0%	0.0%	1.9%	15.3M	0.0bp	19.0M	19.0M	100.0%
RZZ074HA5	0.9	86.1%	0.80	14.3M	9.8M	2.8M	0.8M	0.9M	0.80%	2.8M	14.3M	100.0%	0.0%	1.6%	14.3M	0.0bp	17.1M	17.1M	100.0%
RZZ074HA6	1.0	87.6%	0.79	13.1M	9.0M	2.3M	0.7M	0.7M	0.77%	3.3M	13.1M	100.0%	0.0%	1.8%	13.1M	0.0bp	16.4M	16.4M	100.0%
RZZ074LA1	1.6	90.9%	0.85	14.8M	10.1M	2.7M	0.8M	0.9M	0.81%	3.7M	14.8M	100.0%	0.0%	2.0%	14.8M	0.0bp	18.5M	18.5M	100.0%
RZZ074LA2	1.5	90.8%	0.93	15.2M	10.6M	2.9M	0.8M	0.9M	0.78%	2.8M	15.2M	100.0%	0.0%	1.6%	15.2M	0.0bp	18.1M	18.1M	100.0%
RZZ074LA3	0.8	85.1%	0.85	13.7M	9.2M	2.6M	0.8M	0.8M	0.81%	3.4M	13.7M	100.0%	0.0%	1.9%	13.7M	0.0bp	17.2M	17.2M	100.0%
RZZ074LA4	1.0	87.0%	0.79	12.3M	8.2M	2.2M	0.6M	0.7M	0.75%	3.7M	12.3M	100.0%	0.0%	2.3%	12.3M	0.0bp	16.0M	16.0M	100.0%
RZZ074LA5	1.6	90.7%	0.79	14.9M	10.3M	2.8M	0.8M	0.9M	0.80%	2.9M	14.9M	100.0%	0.0%	1.6%	14.9M	0.0bp	17.8M	17.8M	100.0%
RZZ074LA6	0.3	69.5%	1.20	0.9M	0.6M	0.2M	0.0M	0.1M	0.67%	0.1M	0.9M	100.0%	0.0%	0.8%	0.9M	0.0bp	1.0M	1.0M	100.0%
RZZ075HA1	1.0	86.1%	0.61	12.9M	8.6M	2.5M	0.7M	0.7M	0.81%	3.5M	12.9M	100.0%	0.0%	2.1%	12.9M	0.0bp	16.5M	16.5M	100.0%
RZZ075HA2	1.1	87.7%	0.87	12.2M	8.7M	2.2M	0.6M	0.7M	0.76%	2.0M	12.2M	100.0%	0.0%	1.3%	12.2M	0.0bp	14.2M	14.2M	100.0%
RZZ075HA3	1.4	89.7%	0.79	11.9M	8.1M	2.2M	0.6M	0.7M	0.80%	2.9M	11.9M	100.0%	0.0%	1.8%	11.9M	0.0bp	14.8M	14.8M	100.0%
RZZ075HA4	1.4	89.9%	0.91	13.6M	9.6M	2.4M	0.7M	0.7M	0.76%	3.3M	13.6M	100.0%	0.0%	2.0%	13.6M	0.0bp	17.0M	17.0M	100.0%
RZZ075HA5	1.1	88.2%	0.62	11.7M	8.2M	2.1M	0.6M	0.6M	0.78%	2.3M	11.7M	100.0%	0.0%	1.5%	11.7M	0.0bp	14.1M	14.1M	100.0%
RZZ075HA6	0.9	86.2%	0.76	12.6M	8.7M	2.3M	0.7M	0.7M	0.78%	3.1M	12.6M	100.0%	0.0%	1.9%	12.6M	0.0bp	15.7M	15.7M	100.0%
RZZ075LA1	0.8	82.9%	1.18	11.3M	7.3M	2.3M	0.7M	0.7M	0.83%	3.7M	11.3M	100.0%	0.0%	2.6%	11.3M	0.0bp	15.0M	15.0M	100.0%
RZZ075LA2	0.7	82.3%	0.85	7.7M	5.3M	1.4M	0.4M	0.5M	0.77%	1.6M	7.7M	100.0%	0.0%	1.6%	7.7M	0.0bp	9.2M	9.2M	100.0%
RZZ075LA3	1.1	87.2%	0.88	13.8M	9.3M	2.7M	0.8M	0.8M	0.81%	2.8M	13.8M	100.0%	0.0%	1.6%	13.8M	0.0bp	16.6M	16.6M	100.0%
RZZ075LA4	1.0	86.7%	0.71	11.8M	8.0M	2.2M	0.6M	0.7M	0.76%	2.8M	11.8M	100.0%	0.0%	1.8%	11.8M	0.0bp	14.6M	14.6M	100.0%
RZZ075LA5	0.9	86.9%	1.14	17.6M	11.9M	3.5M	1.0M	1.0M	0.79%	3.6M	17.6M	100.0%	0.0%	1.7%	17.6M	0.0bp	21.2M	21.2M	100.0%
RZZ075LA6	1.2	88.8%	0.85	11.3M	8.1M	1.9M	0.6M	0.7M	0.76%	2.3M	11.3M	100.0%	0.0%	1.6%	11.3M	0.0bp	13.6M	13.6M	100.0%
RZZ076HA1	1.1	87.6%	0.95	12.4M	8.5M	2.2M	0.7M	0.7M	0.81%	2.8M	12.4M	100.0%	0.0%	1.8%	12.4M	0.0bp	15.2M	15.2M	100.0%
RZZ076HA2	1.1	89.0%	0.63	13.8M	10.0M	2.2M	0.7M	0.7M	0.73%	2.6M	13.8M	100.0%	0.0%	1.4%	13.8M	0.0bp	16.4M	16.4M	100.0%
RZZ076HA3	1.0	87.2%	0.84	11.6M	8.0M	2.0M	0.6M	0.7M	0.78%	3.0M	11.6M	100.0%	0.0%	2.0%	11.6M	0.0bp	14.6M	14.6M	100.0%
RZZ076HA4	1.6	92.5%	0.76	14.9M	10.7M	2.3M	0.7M	0.8M	0.73%	3.1M	14.9M	100.0%	0.0%	1.5%	14.9M	0.0bp	18.0M	18.0M	100.0%
RZZ076HA5	1.0	88.1%	0.84	16.3M	11.7M	2.8M	0.8M	1.0M	0.77%	2.8M	16.3M	100.0%	0.0%	1.4%	16.3M	0.0bp	19.1M	19.1M	100.0%
RZZ076HA6	1.0	88.6%	0.64	12.2M	8.8M	1.7M	0.6M	0.7M	0.72%	3.1M	12.2M	100.0%	0.0%	1.8%	12.2M	0.0bp	15.3M	15.3M	100.0%
RZZ076LA1	1.1	87.2%	0.75	11.6M	7.6M	2.4M	0.7M	0.7M	0.82%	2.8M	11.6M	100.0%	0.0%	1.9%	11.6M	0.0bp	14.4M	14.4M	100.0%
RZZ076LA2	0.7	84.4%	0.82	11.0M	7.4M	2.0M	0.6M	0.6M	0.75%	2.6M	11.0M	100.0%	0.0%	1.7%	11.0M	0.0bp	13.6M	13.6M	100.0%
RZZ076LA3	1.0	86.9%	0.77	12.2M	8.4M	2.2M	0.6M	0.7M	0.78%	2.7M	12.2M	100.0%	0.0%	1.7%	12.2M	0.0bp	14.9M	14.9M	100.0%
RZZ076LA4	1.3	89.2%	0.75	13.5M	9.2M	2.4M	0.7M	0.8M	0.76%	3.1M	13.5M	100.0%	0.0%	1.8%	13.5M	0.0bp	16.6M	16.6M	100.0%
RZZ076LA5	0.6	81.7%	0.81	9.8M	6.2M	1.9M	0.6M	0.4M	0.79%	4.6M	9.8M	100.0%	0.0%	3.8%	9.8M	0.0bp	14.4M	14.4M	100.0%
RZZ076LA6	1.1	87.8%	0.78	15.3M	10.3M	2.9M	0.8M	0.9M	0.77%	3.6M	15.3M	100.0%	0.0%	1.8%	15.3M	0.0bp	18.9M	18.9M	100.0%
RZZ996HA1	0.9	83.1%	0.80	9.5M	6.1M	2.0M	0.6M	0.5M	0.86%	2.7M	9.5M	100.0%	0.0%	2.4%	9.5M	0.0bp	12.3M	12.3M	100.0%
RZZ996HA2	0.9	85.2%	0.91	12.2M	8.5M	2.3M	0.7M	0.7M	0.77%	2.0M	12.2M	100.0%	0.0%	1.3%	12.2M	0.0bp	14.2M	14.2M	100.0%
RZZ996HA3	1.1	87.0%	1.04	10.5M	7.2M	2.0M	0.6M	0.6M	0.80%	3.3M	10.5M	100.0%	0.0%	2.5%	10.5M	0.0bp	13.8M	13.8M	100.0%
RZZ996HA4	1.3	89.0%	1.01	13.8M	9.3M	2.6M	0.7M	0.8M	0.77%	3.5M	13.8M	100.0%	0.0%	1.9%	13.8M	0.0bp	17.3M	17.3M	100.0%
RZZ996HA5	1.3	89.3%	0.86	15.6M	10.9M	2.9M	0.9M	1.0M	0.80%	2.6M	15.6M	100.0%	0.0%	1.3%	15.6M	0.0bp	18.2M	18.2M	100.0%
RZZ996HA6	1.2	87.1%	1.04	12.9M	8.6M	2.5M	0.7M	0.7M	0.78%	3.9M	12.9M	100.0%	0.0%	2.5%	12.9M	0.0bp	16.8M	16.8M	100.0%
RZZ996LA1	1.2	88.3%	0.87	13.7M	9.3M	2.6M	0.8M	0.9M	0.81%	3.0M	13.7M	100.0%	0.0%	1.8%	13.7M	0.0bp	16.7M	16.7M	100.0%
RZZ996LA2	1.3	89.3%	0.79	13.2M	9.0M	2.4M	0.7M	0.8M	0.76%	3.1M	13.2M	100.0%	0.0%	1.8%	13.2M	0.0bp	16.3M	16.3M	100.0%
RZZ996LA3	1.0	86.2%	0.73	12.0M	7.9M	2.4M	0.7M	0.7M	0.81%	3.0M	12.0M	100.0%	0.0%	1.9%	12.0M	0.0bp	14.9M	14.9M	100.0%
RZZ996LA4	0.9	85.9%	0.87	14.0M	9.4M	2.7M	0.8M	0.8M	0.77%	3.8M	14.0M	100.0%	0.0%	2.1%	14.0M	0.0bp	17.8M	17.8M	100.0%
RZZ996LA5	1.3	88.5%	1.09	13.7M	9.2M	2.8M	0.8M	0.8M	0.81%	3.0M	13.7M	100.0%	0.0%	1.8%	13.7M	0.0bp	16.7M	16.7M	100.0%
RZZ996LA6	1.9	92.5%	0.58	17.9M	12.4M	3.4M	1.0M	1.0M	0.77%	4.3M	17.9M	100.0%	0.0%	2.0%	17.9M	0.0bp	22.3M	22.3M	100.0%
RZZ997HA1	1.3	88.8%	0.67	15.3M	10.2M	3.0M	0.9M	0.9M	0.82%	3.7M	15.3M	100.0%	0.0%	1.9%	15.3M	0.0bp	19.0M	19.0M	100.0%
RZZ997HA2	1.0	87.1%	0.87	13.7M	9.5M	2.4M	0.8M	0.7M	0.77%	2.6M	13.7M	100.0%	0.0%	1.5%	13.7M	0.0bp	16.3M	16.3M	100.0%
RZZ997HA3	1.2	88.6%	0.66	15.2M	10.4M	2.7M	0.8M	0.9M	0.81%	3.5M	15.2M	100.0%	0.0%	1.8%	15.2M	0.0bp	18.7M	18.7M	100.0%
RZZ997HA4	1.3	89.8%	0.59	17.9M	12.1M	3.3M	0.9M	0.9M	0.79%	4.0M	17.9M	100.0%	0.0%	1.7%	17.9M	0.0bp	21.9M	21.9M	100.0%
RZZ997HA5	1.0	87.0%	0.54	17.6M	11.8M	3.3M	1.0M	1.0M	0.82%	4.2M	17.6M	100.0%	0.0%	1.8%	17.6M	0.0bp	21.8M	21.8M	100.0%
RZZ997HA6	1.1	88.6%	0.73	12.0M	8.4M	1.9M	0.6M	0.6M	0.75%	2.9M	12.0M	100.0%	0.0%	1.7%	12.0M	0.0bp	14.9M	14.9M	100.0%
RZZ997LA1	1.3	89.1%	0.83	13.5M	9.1M	2.7M	0.7M	0.8M	0.80%	2.8M	13.5M	100.0%	0.0%	1.6%	13.5M	0.0bp	16.3M	16.3M	100.0%
RZZ997LA2	1.0	87.5%	0.68	15.7M	10.9M	3.0M	0.9M	1.0M	0.77%	2.4M	15.7M	100.0%	0.0%	1.1%	15.7M	0.0bp	18.1M	18.1M	100.0%
RZZ997LA3	1.2	87.2%	0.85	11.5M	7.6M	2.4M	0.6M	0.6M	0.82%	2.9M	11.5M	100.0%	0.0%	2.0%	11.5M	0.0bp	14.4M	14.4M	100.0%
RZZ997LA4	1.1	87.3%	0.86	13.5M	9.1M	2.6M	0.7M	0.8M	0.77%	3.1M	13.5M	100.0%	0.0%	1.8%	13.5M	0.0bp	16.6M	16.6M	100.0%
RZZ997LA5	1.2	88.6%	0.80	14.6M	10.0M	2.8M	0.8M	0.9M	0.79%	3.0M	14.6M	100.0%	0.0%	1.6%	14.6M	0.0bp	17.6M	17.6M	100.0%
RZZ997LA6	0.8	82.5%	0.85	7.4M	5.1M	1.4M	0.4M	0.4M	0.78%	1.6M	7.4M	100.0%	0.0%	1.6%	7.4M	0.0bp	9.0M	9.0M	100.0%
RZZ999ZA1	1.1	86.6%	0.89	12.0M	8.1M	2.4M	0.7M	0.8M	0.82%	3.0M	12.0M	100.0%	0.0%	2.1%	12.0M	0.0bp	15.0M	15.0M	100.0%
RZZ999ZA2	0.8	84.3%	0.88	9.9M	6.9M	1.8M	0.5M	0.6M	0.77%	1.7M	9.9M	100.0%	0.0%	1.3%	9.9M	0.0bp	11.5M	11.5M	100.0%
RZZ999ZA3	1.5	89.8%	0.75	13.6M	9.2M	2.6M	0.8M	0.8M	0.81%	3.3M	13.6M	100.0%	0.0%	1.9%	13.6M	0.0bp	16.9M	16.9M	100.0%
RZZ999ZA4	1.2	89.3%	0.74	16.9M	11.5M	3.2M	0.9M	1.0M	0.78%	3.7M	16.9M	100.0%	0.0%	1.7%	16.9M	0.0bp	20.6M	20.6M	100.0%
RZZ999ZA5	1.2	88.6%	0.77	17.4M	12.0M	3.2M	0.9M	1.2M	0.79%	3.1M	17.4M	100.0%	0.0%	1.4%	17.4M	0.0bp	20.5M	20.5M	100.0%
RZZ999ZA6	1.3	89.4%	0.91	17.7M	11.9M	3.3M	1.0M	1.0M	0.78%	4.3M	17.7M	100.0%	0.0%	1.9%	17.7M	0.0bp	22.0M	22.0M	100.0%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: DupRadar	dupInt	Intercept value from DupRadar	`custom_content_dupradar-dupRadar_intercept`
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`picard_mark_duplicates-PERCENT_DUPLICATION`
\|\|	QualiMap: RNASeq	5'-3' bias	5'-3' bias	`qualimap_rnaseq-5_3_bias`
\|\|	QualiMap: RNASeq	M Aligned	Reads Aligned (millions)	`qualimap_rnaseq-reads_aligned`	read_count
\|\|	QualiMap: RNASeq	Exonic	Reads aligned to exonic regions	`qualimap_rnaseq-reads_aligned_exonic`	read_count
\|\|	QualiMap: RNASeq	Intronic	Reads aligned to intronic regions	`qualimap_rnaseq-reads_aligned_intronic`	read_count
\|\|	QualiMap: RNASeq	Intergenic	Reads aligned to intergenic regions	`qualimap_rnaseq-reads_aligned_intergenic`	read_count
\|\|	QualiMap: RNASeq	Overlapping Exon	Reads aligned to overlapping exon regions	`qualimap_rnaseq-reads_aligned_overlapping_exon`	read_count
\|\|	Samtools: stats	Error rate	Error rate: mismatches (NM) / bases mapped (CIGAR)	`samtools_stats-error_rate`
\|\|	Samtools: stats	Non-primary	Non-primary alignments (millions)	`samtools_stats-non_primary_alignments`	read_count
\|\|	Samtools: stats	Reads mapped	Reads mapped in the bam file (millions)	`samtools_stats-reads_mapped`	read_count
\|\|	Samtools: stats	% Mapped	% Mapped reads	`samtools_stats-reads_mapped_percent`
\|\|	Samtools: stats	% Proper pairs	% Properly paired reads	`samtools_stats-reads_properly_paired_percent`
\|\|	Samtools: stats	% MapQ 0 reads	% of reads that are ambiguously placed (MapQ=0)	`samtools_stats-reads_MQ0_percent`
\|\|	Samtools: stats	Total seqs	Total sequences in the bam file (millions)	`samtools_stats-raw_total_sequences`	read_count
\|\|	Samtools: stats	Mean insert	Average insert size	`samtools_stats-insert_size_average`
\|\|	Samtools: flagstat	Reads	Total reads in the bam file (millions)	`samtools_flagstat-flagstat_total`	read_count
\|\|	Samtools: flagstat	Reads mapped	Reads mapped in the bam file (millions)	`samtools_flagstat-mapped_passed`	read_count
\|\|	Samtools: flagstat	% Reads mapped	% Reads mapped in the bam file	`samtools_flagstat-mapped_passed_pct`

Sample status checks

Reports on sample strandedness status, and any failures in trimming or mapping.

Strandedness Checks

The strandedness used for analysis in this workflow can either be provided by the user or automatically inferred by Salmon using a sample of reads. In both cases, strandedness is verified at the end of the workflow using RSeQC's infer_experiment.py on genomic alignments. In this table, a pass indicates a match between the supplied strandedness (or that inferred by Salmon) and RSeQC results. A fail indicates a mismatch or 'undetermined' strandedness. 'Undetermined' strandedness can signal QC issues, including potential genomic DNA contamination.

Note: Rows are duplicated for an 'auto' setting to allow comparison of statistics between inference methods.

Showing ¹⁹²/₁₉₂ rows and ⁷/₇ columns.

Sample	Status	Strand inference method	Provided strandedness	Inferred strandedness	Sense (%)	Antisense (%)	Unstranded (%)
RZY000ZA1	pass	RSeQC	forward	forward	88.3	4.0	7.6
RZY000ZA2	pass	RSeQC	forward	forward	88.4	3.9	7.7
RZY000ZA3	pass	RSeQC	forward	forward	88.5	3.9	7.6
RZY000ZA4	pass	RSeQC	forward	forward	88.1	4.4	7.5
RZY000ZA5	pass	RSeQC	forward	forward	88.4	3.8	7.8
RZY000ZA6	pass	RSeQC	forward	forward	88.3	4.3	7.5
RZY019HA1	pass	RSeQC	forward	forward	88.3	4.1	7.5
RZY019HA2	pass	RSeQC	forward	forward	88.2	4.0	7.8
RZY019HA3	pass	RSeQC	forward	forward	88.7	3.9	7.4
RZY019HA4	pass	RSeQC	forward	forward	88.9	3.8	7.3
RZY019HA5	pass	RSeQC	forward	forward	88.2	4.3	7.5
RZY019HA6	pass	RSeQC	forward	forward	88.5	4.1	7.4
RZY019LA1	pass	RSeQC	forward	forward	87.1	4.3	8.6
RZY019LA2	pass	RSeQC	forward	forward	88.4	4.1	7.5
RZY019LA3	pass	RSeQC	forward	forward	88.4	4.5	7.2
RZY019LA4	pass	RSeQC	forward	forward	88.4	4.3	7.3
RZY019LA5	pass	RSeQC	forward	forward	88.5	4.0	7.5
RZY019LA6	pass	RSeQC	forward	forward	88.5	3.8	7.6
RZY996LA1	pass	RSeQC	forward	forward	88.0	4.2	7.8
RZY996LA2	pass	RSeQC	forward	forward	87.5	4.0	8.5
RZY996LA3	pass	RSeQC	forward	forward	88.4	4.4	7.2
RZY996LA4	pass	RSeQC	forward	forward	88.1	4.5	7.4
RZY996LA5	pass	RSeQC	forward	forward	88.3	4.0	7.7
RZY996LA6	pass	RSeQC	forward	forward	88.5	4.3	7.2
RZY996MA1	pass	RSeQC	forward	forward	87.5	4.4	8.1
RZY996MA2	pass	RSeQC	forward	forward	88.6	3.9	7.5
RZY996MA3	pass	RSeQC	forward	forward	88.1	4.5	7.3
RZY996MA4	pass	RSeQC	forward	forward	88.5	3.9	7.6
RZY996MA5	pass	RSeQC	forward	forward	88.1	4.6	7.3
RZY996MA6	pass	RSeQC	forward	forward	88.4	4.4	7.2
RZY999ZA1	pass	RSeQC	forward	forward	88.1	4.3	7.6
RZY999ZA2	pass	RSeQC	forward	forward	87.9	3.7	8.3
RZY999ZA3	pass	RSeQC	forward	forward	88.6	3.9	7.5
RZY999ZA4	pass	RSeQC	forward	forward	88.6	4.3	7.1
RZY999ZA5	pass	RSeQC	forward	forward	88.3	4.5	7.2
RZY999ZA6	pass	RSeQC	forward	forward	88.5	4.2	7.3
RZZ000ZA1	pass	RSeQC	forward	forward	88.8	3.3	7.9
RZZ000ZA2	pass	RSeQC	forward	forward	89.2	3.0	7.8
RZZ000ZA3	pass	RSeQC	forward	forward	89.0	3.3	7.7
RZZ000ZA4	pass	RSeQC	forward	forward	89.6	3.3	7.1
RZZ000ZA5	pass	RSeQC	forward	forward	89.0	3.3	7.6
RZZ000ZA6	pass	RSeQC	forward	forward	89.1	3.9	7.0
RZZ014HA1	pass	RSeQC	forward	forward	88.8	3.5	7.7
RZZ014HA2	pass	RSeQC	forward	forward	89.2	3.5	7.2
RZZ014HA3	pass	RSeQC	forward	forward	89.1	3.8	7.2
RZZ014HA4	pass	RSeQC	forward	forward	88.7	3.6	7.7
RZZ014HA5	pass	RSeQC	forward	forward	88.7	3.8	7.5
RZZ014HA6	pass	RSeQC	forward	forward	88.6	3.8	7.5
RZZ014LA1	pass	RSeQC	forward	forward	89.0	3.5	7.5
RZZ014LA2	pass	RSeQC	forward	forward	89.2	3.5	7.3
RZZ014LA3	pass	RSeQC	forward	forward	88.7	3.5	7.8
RZZ014LA4	pass	RSeQC	forward	forward	88.8	3.6	7.6
RZZ014LA5	pass	RSeQC	forward	forward	89.0	3.1	7.9
RZZ014LA6	pass	RSeQC	forward	forward	89.1	3.1	7.8
RZZ015HA1	pass	RSeQC	forward	forward	88.3	4.0	7.7
RZZ015HA2	pass	RSeQC	forward	forward	88.5	3.8	7.6
RZZ015HA3	pass	RSeQC	forward	forward	88.8	3.6	7.6
RZZ015HA4	pass	RSeQC	forward	forward	88.4	3.8	7.8
RZZ015HA5	pass	RSeQC	forward	forward	88.6	3.9	7.5
RZZ015HA6	pass	RSeQC	forward	forward	88.0	4.6	7.4
RZZ015LA1	pass	RSeQC	forward	forward	89.2	3.5	7.2
RZZ015LA2	pass	RSeQC	forward	forward	89.4	3.1	7.5
RZZ015LA3	pass	RSeQC	forward	forward	89.0	3.4	7.6
RZZ015LA4	pass	RSeQC	forward	forward	88.7	3.9	7.4
RZZ015LA5	pass	RSeQC	forward	forward	88.7	3.9	7.4
RZZ015LA6	pass	RSeQC	forward	forward	89.1	3.6	7.3
RZZ016HA1	pass	RSeQC	forward	forward	88.1	4.1	7.8
RZZ016HA2	pass	RSeQC	forward	forward	88.5	4.3	7.2
RZZ016HA3	pass	RSeQC	forward	forward	88.1	4.3	7.6
RZZ016HA4	pass	RSeQC	forward	forward	87.6	4.9	7.6
RZZ016HA5	pass	RSeQC	forward	forward	87.7	5.0	7.3
RZZ016HA6	pass	RSeQC	forward	forward	87.1	4.8	8.2
RZZ016LA1	pass	RSeQC	forward	forward	89.3	3.9	6.8
RZZ016LA2	pass	RSeQC	forward	forward	89.3	3.3	7.4
RZZ016LA3	pass	RSeQC	forward	forward	89.1	3.4	7.5
RZZ016LA4	pass	RSeQC	forward	forward	89.1	3.5	7.4
RZZ016LA5	pass	RSeQC	forward	forward	88.6	3.6	7.8
RZZ016LA6	pass	RSeQC	forward	forward	89.2	3.3	7.5
RZZ017HA1	pass	RSeQC	forward	forward	88.0	4.2	7.7
RZZ017HA2	pass	RSeQC	forward	forward	88.1	4.4	7.4
RZZ017HA3	pass	RSeQC	forward	forward	88.7	3.9	7.4
RZZ017HA4	pass	RSeQC	forward	forward	88.5	4.4	7.1
RZZ017HA5	pass	RSeQC	forward	forward	88.4	3.8	7.8
RZZ017HA6	pass	RSeQC	forward	forward	87.8	3.8	8.4
RZZ017LA1	pass	RSeQC	forward	forward	88.9	3.6	7.5
RZZ017LA2	pass	RSeQC	forward	forward	89.3	3.2	7.5
RZZ017LA3	pass	RSeQC	forward	forward	88.9	3.4	7.6
RZZ017LA4	pass	RSeQC	forward	forward	88.7	3.6	7.6
RZZ017LA5	pass	RSeQC	forward	forward	89.2	3.3	7.5
RZZ017LA6	pass	RSeQC	forward	forward	89.2	3.2	7.7
RZZ018HA1	pass	RSeQC	forward	forward	88.4	4.0	7.6
RZZ018HA2	pass	RSeQC	forward	forward	89.0	3.7	7.3
RZZ018HA3	pass	RSeQC	forward	forward	89.1	3.8	7.1
RZZ018HA4	pass	RSeQC	forward	forward	89.3	3.7	7.0
RZZ018HA5	pass	RSeQC	forward	forward	89.2	3.7	7.2
RZZ018HA6	pass	RSeQC	forward	forward	88.6	4.0	7.4
RZZ018LA1	pass	RSeQC	forward	forward	88.9	3.4	7.7
RZZ018LA2	pass	RSeQC	forward	forward	88.7	3.8	7.6
RZZ018LA3	pass	RSeQC	forward	forward	88.7	3.5	7.8
RZZ018LA4	pass	RSeQC	forward	forward	88.6	3.8	7.6
RZZ018LA5	pass	RSeQC	forward	forward	89.1	3.3	7.5
RZZ018LA6	pass	RSeQC	forward	forward	89.0	3.6	7.3
RZZ019HA1	pass	RSeQC	forward	forward	88.9	3.4	7.7
RZZ019HA2	pass	RSeQC	forward	forward	88.7	3.4	7.9
RZZ019HA3	pass	RSeQC	forward	forward	89.2	3.6	7.3
RZZ019HA4	pass	RSeQC	forward	forward	88.4	3.7	7.9
RZZ019HA5	pass	RSeQC	forward	forward	87.9	3.3	8.8
RZZ019HA6	pass	RSeQC	forward	forward	88.5	3.6	7.9
RZZ019LA1	pass	RSeQC	forward	forward	88.9	3.9	7.2
RZZ019LA2	pass	RSeQC	forward	forward	89.2	3.3	7.6
RZZ019LA3	pass	RSeQC	forward	forward	89.0	3.4	7.6
RZZ019LA4	pass	RSeQC	forward	forward	89.1	3.6	7.2
RZZ019LA5	pass	RSeQC	forward	forward	89.0	3.3	7.7
RZZ019LA6	pass	RSeQC	forward	forward	88.8	3.4	7.8
RZZ035HA1	pass	RSeQC	forward	forward	88.8	3.7	7.5
RZZ035HA2	pass	RSeQC	forward	forward	89.0	3.3	7.7
RZZ035HA3	pass	RSeQC	forward	forward	89.0	3.5	7.5
RZZ035HA4	pass	RSeQC	forward	forward	88.3	3.7	8.0
RZZ035HA5	pass	RSeQC	forward	forward	88.9	3.5	7.5
RZZ035HA6	pass	RSeQC	forward	forward	89.0	3.5	7.5
RZZ035LA1	pass	RSeQC	forward	forward	88.6	3.5	7.9
RZZ035LA2	pass	RSeQC	forward	forward	89.5	3.2	7.3
RZZ035LA3	pass	RSeQC	forward	forward	88.5	3.6	7.9
RZZ035LA4	pass	RSeQC	forward	forward	88.7	3.9	7.4
RZZ035LA5	pass	RSeQC	forward	forward	88.9	3.8	7.3
RZZ035LA6	pass	RSeQC	forward	forward	88.7	3.6	7.7
RZZ074HA1	pass	RSeQC	forward	forward	88.3	3.8	7.9
RZZ074HA2	pass	RSeQC	forward	forward	88.4	4.2	7.4
RZZ074HA3	pass	RSeQC	forward	forward	87.6	3.8	8.7
RZZ074HA4	pass	RSeQC	forward	forward	88.7	4.0	7.3
RZZ074HA5	pass	RSeQC	forward	forward	88.8	3.7	7.4
RZZ074HA6	pass	RSeQC	forward	forward	88.4	4.1	7.5
RZZ074LA1	pass	RSeQC	forward	forward	88.6	3.7	7.7
RZZ074LA2	pass	RSeQC	forward	forward	89.2	3.2	7.6
RZZ074LA3	pass	RSeQC	forward	forward	89.2	3.3	7.5
RZZ074LA4	pass	RSeQC	forward	forward	88.7	3.7	7.6
RZZ074LA5	pass	RSeQC	forward	forward	89.0	3.5	7.5
RZZ074LA6	pass	RSeQC	forward	forward	88.5	2.1	9.4
RZZ075HA1	pass	RSeQC	forward	forward	88.9	3.8	7.3
RZZ075HA2	pass	RSeQC	forward	forward	89.0	3.4	7.6
RZZ075HA3	pass	RSeQC	forward	forward	88.6	3.8	7.5
RZZ075HA4	pass	RSeQC	forward	forward	88.5	4.0	7.4
RZZ075HA5	pass	RSeQC	forward	forward	88.9	3.7	7.4
RZZ075HA6	pass	RSeQC	forward	forward	88.7	3.8	7.5
RZZ075LA1	pass	RSeQC	forward	forward	88.9	4.0	7.1
RZZ075LA2	pass	RSeQC	forward	forward	89.2	3.1	7.6
RZZ075LA3	pass	RSeQC	forward	forward	89.2	3.3	7.4
RZZ075LA4	pass	RSeQC	forward	forward	88.8	3.4	7.8
RZZ075LA5	pass	RSeQC	forward	forward	89.2	3.6	7.2
RZZ075LA6	pass	RSeQC	forward	forward	88.9	3.3	7.8
RZZ076HA1	pass	RSeQC	forward	forward	88.2	3.9	7.9
RZZ076HA2	pass	RSeQC	forward	forward	88.4	4.2	7.4
RZZ076HA3	pass	RSeQC	forward	forward	88.4	4.0	7.6
RZZ076HA4	pass	RSeQC	forward	forward	88.0	4.1	7.9
RZZ076HA5	pass	RSeQC	forward	forward	88.4	4.0	7.6
RZZ076HA6	pass	RSeQC	forward	forward	87.6	4.5	7.9
RZZ076LA1	pass	RSeQC	forward	forward	88.9	3.7	7.4
RZZ076LA2	pass	RSeQC	forward	forward	89.2	3.3	7.5
RZZ076LA3	pass	RSeQC	forward	forward	88.5	3.5	8.1
RZZ076LA4	pass	RSeQC	forward	forward	89.0	3.4	7.6
RZZ076LA5	pass	RSeQC	forward	forward	88.9	4.4	6.6
RZZ076LA6	pass	RSeQC	forward	forward	88.9	3.5	7.5
RZZ996HA1	pass	RSeQC	forward	forward	88.6	4.0	7.4
RZZ996HA2	pass	RSeQC	forward	forward	89.2	3.3	7.6
RZZ996HA3	pass	RSeQC	forward	forward	89.1	3.4	7.5
RZZ996HA4	pass	RSeQC	forward	forward	88.8	3.5	7.6
RZZ996HA5	pass	RSeQC	forward	forward	89.1	3.2	7.7
RZZ996HA6	pass	RSeQC	forward	forward	89.0	3.8	7.2
RZZ996LA1	pass	RSeQC	forward	forward	88.9	3.5	7.6
RZZ996LA2	pass	RSeQC	forward	forward	88.6	3.5	8.0
RZZ996LA3	pass	RSeQC	forward	forward	89.0	3.5	7.4
RZZ996LA4	pass	RSeQC	forward	forward	89.1	3.5	7.4
RZZ996LA5	pass	RSeQC	forward	forward	89.0	3.5	7.5
RZZ996LA6	pass	RSeQC	forward	forward	88.6	3.9	7.5
RZZ997HA1	pass	RSeQC	forward	forward	88.3	4.0	7.7
RZZ997HA2	pass	RSeQC	forward	forward	88.8	3.7	7.5
RZZ997HA3	pass	RSeQC	forward	forward	88.5	3.8	7.7
RZZ997HA4	pass	RSeQC	forward	forward	88.5	4.2	7.3
RZZ997HA5	pass	RSeQC	forward	forward	88.2	4.1	7.8
RZZ997HA6	pass	RSeQC	forward	forward	88.4	3.7	7.9
RZZ997LA1	pass	RSeQC	forward	forward	88.9	3.5	7.6
RZZ997LA2	pass	RSeQC	forward	forward	89.2	3.1	7.6
RZZ997LA3	pass	RSeQC	forward	forward	89.2	3.5	7.3
RZZ997LA4	pass	RSeQC	forward	forward	89.1	3.4	7.5
RZZ997LA5	pass	RSeQC	forward	forward	89.2	3.3	7.5
RZZ997LA6	pass	RSeQC	forward	forward	89.1	3.4	7.5
RZZ999ZA1	pass	RSeQC	forward	forward	88.4	3.8	7.7
RZZ999ZA2	pass	RSeQC	forward	forward	89.2	3.2	7.6
RZZ999ZA3	pass	RSeQC	forward	forward	88.6	3.5	7.8
RZZ999ZA4	pass	RSeQC	forward	forward	89.2	3.5	7.3
RZZ999ZA5	pass	RSeQC	forward	forward	88.9	3.3	7.8
RZZ999ZA6	pass	RSeQC	forward	forward	88.8	3.6	7.6

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fail_strand_check_table_table

Sort	Column	Description	ID
\|\|	Status	Pass if the strandedness inferred by RSeQC matches that provided by the user or predicted by Salmon. Fail otherwise.	`samples_strandedness_check-Status`
\|\|	Strand inference method	Tool used to detect strandedness	`samples_strandedness_check-Strand_inference_method`
\|\|	Provided strandedness	User-provided strandedness	`samples_strandedness_check-Provided_strandedness`
\|\|	Inferred strandedness	Interred strandedness	`samples_strandedness_check-Inferred_strandedness`
\|\|	Sense (%)	Sense (%)	`samples_strandedness_check-Sense`
\|\|	Antisense (%)	Antisense (%)	`samples_strandedness_check-Antisense`
\|\|	Unstranded (%)	Unstranded (%)	`samples_strandedness_check-Unstranded`

DupRadar

DupRadar provides duplication rate quality control for RNA-Seq datasets. Highly expressed genes can be expected to have a lot of duplicate reads, but high numbers of duplicates at low read counts can indicate low library complexity with technical duplication. This plot shows the general linear models - a summary of the gene duplication distributions.bioconductor.org/packages/release/bioc/html/dupRadar.html

Created with MultiQC

Picard

Tools for manipulating high-throughput sequencing data.http://broadinstitute.github.io/picard

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Estimates library complexity, showing how many additional unique reads are sequenced for increasing total read count.http://smithlabresearch.org/software/preseqDOI: 10.1038/nmeth.2375

A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

QualiMap

Quality control of alignment data and its derivatives like feature counts.http://qualimap.bioinfo.cipf.esDOI: 10.1093/bioinformatics/btv566; 10.1093/bioinformatics/bts503

Genomic origin of reads

Classification of mapped reads as originating in exonic, intronic or intergenic regions. These can be displayed as either the number or percentage of mapped reads.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. This allows mapped reads to be grouped by whether they originate in an exonic region (for QualiMap, this may include 5′ and 3′ UTR regions as well as protein-coding exons), an intron, or an intergenic region (see the Qualimap 2 documentation).

The inferred genomic origins of RNA-seq reads are presented here as a bar graph showing either the number or percentage of mapped reads in each read dataset that have been assigned to each type of genomic region. This graph can be used to assess the proportion of useful reads in an RNA-seq experiment. That proportion can be reduced by the presence of intron sequences, especially if depletion of ribosomal RNA was used during sample preparation (Sims et al. 2014). It can also be reduced by off-target transcripts, which are detected in greater numbers at the sequencing depths needed to detect poorly-expressed transcripts (Tarazona et al. 2011).

Created with MultiQC

Gene Coverage Profile

Mean distribution of coverage depth across the length of all mapped transcripts.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. QualiMap uses this information to calculate the depth of coverage along the length of each annotated transcript. For a set of reads mapped to a transcript, the depth of coverage at a given base position is the number of high-quality reads that map to the transcript at that position (Sims et al. 2014).

QualiMap calculates coverage depth at every base position of each annotated transcript. To enable meaningful comparison between transcripts, base positions are rescaled to relative positions expressed as percentage distance along each transcript (0%, 1%, …, 99%). For the set of transcripts with at least one mapped read, QualiMap plots the cumulative mapped-read depth (y-axis) at each relative transcript position (x-axis). This plot shows the gene coverage profile across all mapped transcripts for each read dataset. It provides a visual way to assess positional biases, such as an accumulation of mapped reads at the 3′ end of transcripts, which may indicate poor RNA quality in the original sample (Conesa et al. 2016).

The Normalised plot is calculated by MultiQC to enable comparison of samples with varying sequencing depth. The cumulative mapped-read depth at each position across the averaged transcript position are divided by the total for that sample across the entire averaged transcript.

Created with MultiQC

RSeQC

Evaluates high throughput RNA-seq data.http://rseqc.sourceforge.netDOI: 10.1093/bioinformatics/bts356

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹⁰/₁₀ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	+ve strand	-ve strand	Non-splice reads	Splice reads
RZY000ZA1	23.0M	0.0M	16.4M	5.4M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZY000ZA2	11.2M	0.0M	6.8M	3.3M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZY000ZA3	12.4M	0.0M	7.7M	3.5M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZY000ZA4	14.6M	0.0M	9.3M	3.8M	0.0M	1.3M	0.6M	0.6M	1.2M	0.1M
RZY000ZA5	11.6M	0.0M	7.4M	2.7M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZY000ZA6	11.8M	0.0M	7.6M	3.0M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZY019HA1	11.6M	0.0M	6.8M	3.4M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZY019HA2	10.6M	0.0M	6.3M	2.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY019HA3	14.5M	0.0M	9.2M	3.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY019HA4	15.3M	0.0M	9.9M	3.6M	0.0M	1.5M	0.8M	0.8M	1.4M	0.1M
RZY019HA5	12.5M	0.0M	8.2M	2.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY019HA6	13.3M	0.0M	8.7M	3.1M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY019LA1	11.5M	0.0M	7.3M	3.3M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
RZY019LA2	19.2M	0.0M	12.1M	5.4M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZY019LA3	16.0M	0.0M	10.2M	4.2M	0.0M	1.3M	0.7M	0.7M	1.2M	0.1M
RZY019LA4	15.1M	0.0M	9.8M	3.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY019LA5	15.0M	0.0M	10.1M	3.5M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY019LA6	12.6M	0.0M	8.4M	2.8M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY996LA1	28.5M	0.0M	19.4M	7.7M	0.0M	1.3M	0.6M	0.6M	1.2M	0.1M
RZY996LA2	12.5M	0.0M	8.1M	3.4M	0.0M	0.8M	0.4M	0.4M	0.8M	0.1M
RZY996LA3	11.4M	0.0M	7.1M	2.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY996LA4	12.8M	0.0M	7.8M	3.8M	0.0M	1.1M	0.5M	0.5M	1.0M	0.1M
RZY996LA5	14.0M	0.0M	9.4M	3.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY996LA6	13.8M	0.0M	8.9M	3.5M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY996MA1	18.6M	0.0M	11.6M	6.0M	0.0M	0.8M	0.4M	0.4M	0.8M	0.1M
RZY996MA2	12.7M	0.0M	8.2M	3.1M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY996MA3	12.4M	0.0M	8.0M	3.1M	0.0M	1.1M	0.6M	0.6M	1.0M	0.1M
RZY996MA4	13.0M	0.0M	8.2M	3.4M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY996MA5	11.9M	0.0M	7.7M	3.0M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZY996MA6	12.0M	0.0M	8.0M	2.8M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZY999ZA1	31.4M	0.0M	20.4M	9.5M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZY999ZA2	8.5M	0.0M	5.3M	2.2M	0.0M	0.8M	0.4M	0.4M	0.8M	0.1M
RZY999ZA3	13.8M	0.0M	8.6M	3.8M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY999ZA4	14.0M	0.0M	8.7M	4.0M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZY999ZA5	11.8M	0.0M	7.5M	3.0M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZY999ZA6	12.4M	0.0M	8.2M	3.0M	0.0M	1.1M	0.5M	0.5M	1.0M	0.1M
RZZ000ZA1	13.9M	0.0M	9.9M	2.7M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ000ZA2	9.1M	0.0M	7.3M	1.2M	0.0M	0.6M	0.3M	0.3M	0.5M	0.0M
RZZ000ZA3	16.4M	0.0M	11.9M	2.9M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ000ZA4	20.7M	0.0M	15.1M	3.5M	0.0M	1.9M	0.9M	1.0M	1.8M	0.1M
RZZ000ZA5	23.9M	0.0M	17.9M	3.6M	0.0M	2.1M	1.0M	1.1M	1.9M	0.2M
RZZ000ZA6	17.7M	0.0M	12.5M	3.7M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ014HA1	14.8M	0.0M	11.0M	2.6M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZZ014HA2	16.8M	0.0M	13.1M	2.2M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ014HA3	15.6M	0.0M	10.3M	3.5M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ014HA4	19.8M	0.0M	14.5M	3.7M	0.0M	1.5M	0.7M	0.7M	1.3M	0.1M
RZZ014HA5	16.5M	0.0M	12.5M	2.5M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ014HA6	19.3M	0.0M	13.7M	3.8M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ014LA1	17.9M	0.0M	12.5M	3.6M	0.0M	1.6M	0.8M	0.8M	1.4M	0.1M
RZZ014LA2	17.9M	0.0M	13.6M	2.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ014LA3	17.9M	0.0M	13.0M	3.4M	0.0M	1.4M	0.7M	0.7M	1.2M	0.1M
RZZ014LA4	16.3M	0.0M	11.7M	3.1M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ014LA5	17.6M	0.0M	13.2M	2.4M	0.0M	1.9M	0.9M	1.0M	1.7M	0.2M
RZZ014LA6	13.1M	0.0M	9.8M	1.8M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ015HA1	17.4M	0.0M	12.5M	3.1M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ015HA2	12.9M	0.0M	9.2M	2.1M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ015HA3	18.6M	0.0M	13.3M	3.2M	0.0M	1.8M	0.9M	0.9M	1.7M	0.1M
RZZ015HA4	16.3M	0.0M	11.8M	3.1M	0.0M	1.3M	0.6M	0.6M	1.1M	0.1M
RZZ015HA5	21.6M	0.0M	16.1M	3.7M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ015HA6	18.5M	0.0M	13.0M	4.1M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ015LA1	17.0M	0.0M	11.8M	3.2M	0.0M	1.8M	0.9M	0.9M	1.6M	0.1M
RZZ015LA2	16.9M	0.0M	12.6M	2.3M	0.0M	1.9M	0.9M	1.0M	1.7M	0.2M
RZZ015LA3	15.0M	0.0M	10.9M	2.8M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ015LA4	17.7M	0.0M	12.5M	3.6M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ015LA5	20.7M	0.0M	14.3M	4.2M	0.0M	1.9M	0.9M	1.0M	1.7M	0.2M
RZZ015LA6	18.9M	0.0M	13.6M	3.6M	0.0M	1.5M	0.7M	0.8M	1.3M	0.1M
RZZ016HA1	17.8M	0.0M	13.1M	3.1M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ016HA2	19.6M	0.0M	14.5M	3.5M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ016HA3	18.6M	0.0M	13.5M	3.6M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ016HA4	16.4M	0.0M	11.6M	3.4M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ016HA5	18.0M	0.0M	11.2M	5.0M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ016HA6	14.9M	0.0M	10.8M	3.0M	0.0M	0.9M	0.4M	0.5M	0.8M	0.1M
RZZ016LA1	15.5M	0.0M	9.9M	3.6M	0.0M	1.8M	0.8M	0.9M	1.6M	0.1M
RZZ016LA2	14.5M	0.0M	10.7M	2.1M	0.0M	1.6M	0.8M	0.8M	1.4M	0.1M
RZZ016LA3	19.8M	0.0M	14.2M	3.7M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ016LA4	19.2M	0.0M	13.9M	3.4M	0.0M	1.7M	0.8M	0.9M	1.6M	0.1M
RZZ016LA5	16.2M	0.0M	12.1M	2.5M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ016LA6	16.1M	0.0M	11.8M	2.7M	0.0M	1.5M	0.7M	0.7M	1.3M	0.1M
RZZ017HA1	17.2M	0.0M	12.5M	3.4M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ017HA2	22.2M	0.0M	16.4M	4.3M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ017HA3	18.8M	0.0M	13.2M	4.1M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ017HA4	18.1M	0.0M	12.2M	4.0M	0.0M	1.7M	0.8M	0.9M	1.5M	0.1M
RZZ017HA5	15.2M	0.0M	11.5M	2.5M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZZ017HA6	16.2M	0.0M	12.0M	3.2M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZZ017LA1	17.0M	0.0M	12.0M	3.4M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ017LA2	15.8M	0.0M	11.8M	2.4M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ017LA3	17.2M	0.0M	12.4M	3.2M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ017LA4	14.8M	0.0M	10.6M	2.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ017LA5	16.0M	0.0M	12.1M	2.4M	0.0M	1.5M	0.7M	0.7M	1.3M	0.1M
RZZ017LA6	16.1M	0.0M	13.1M	1.8M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ018HA1	15.6M	0.0M	10.5M	3.4M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ018HA2	16.9M	0.0M	12.4M	2.7M	0.0M	1.7M	0.8M	0.9M	1.5M	0.1M
RZZ018HA3	21.2M	0.0M	15.4M	3.9M	0.0M	1.7M	0.8M	0.9M	1.6M	0.1M
RZZ018HA4	18.2M	0.0M	13.1M	3.1M	0.0M	1.8M	0.9M	0.9M	1.7M	0.1M
RZZ018HA5	14.9M	0.0M	9.9M	3.1M	0.0M	1.7M	0.8M	0.9M	1.6M	0.1M
RZZ018HA6	20.8M	0.0M	15.5M	3.7M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ018LA1	14.4M	0.0M	10.7M	2.4M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ018LA2	23.6M	0.0M	16.1M	5.1M	0.0M	2.1M	1.0M	1.1M	2.0M	0.2M
RZZ018LA3	14.4M	0.0M	10.5M	2.7M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZZ018LA4	18.8M	0.0M	13.4M	3.8M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ018LA5	13.9M	0.0M	10.1M	2.2M	0.0M	1.5M	0.7M	0.8M	1.3M	0.1M
RZZ018LA6	19.6M	0.0M	14.4M	3.6M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ019HA1	12.9M	0.0M	9.1M	2.6M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZZ019HA2	13.8M	0.0M	10.2M	2.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ019HA3	16.1M	0.0M	10.6M	3.3M	0.0M	1.9M	0.9M	1.0M	1.8M	0.1M
RZZ019HA4	17.0M	0.0M	12.3M	3.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ019HA5	10.1M	0.0M	7.0M	2.0M	0.0M	0.9M	0.5M	0.5M	0.9M	0.1M
RZZ019HA6	16.0M	0.0M	11.0M	3.4M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ019LA1	14.1M	0.0M	8.9M	3.5M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ019LA2	8.6M	0.0M	5.9M	1.5M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ019LA3	15.8M	0.0M	10.7M	3.2M	0.0M	1.7M	0.8M	0.9M	1.5M	0.1M
RZZ019LA4	21.7M	0.0M	15.7M	4.1M	0.0M	1.7M	0.8M	0.9M	1.6M	0.1M
RZZ019LA5	20.9M	0.0M	15.7M	3.1M	0.0M	1.9M	0.9M	1.0M	1.7M	0.2M
RZZ019LA6	11.0M	0.0M	7.5M	1.9M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ035HA1	17.6M	0.0M	12.6M	3.5M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ035HA2	15.1M	0.0M	10.2M	3.2M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ035HA3	16.6M	0.0M	11.6M	3.2M	0.0M	1.6M	0.8M	0.8M	1.4M	0.1M
RZZ035HA4	13.2M	0.0M	9.8M	2.6M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
RZZ035HA5	19.1M	0.0M	14.3M	3.2M	0.0M	1.6M	0.8M	0.8M	1.4M	0.1M
RZZ035HA6	15.5M	0.0M	11.0M	2.8M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ035LA1	15.0M	0.0M	10.6M	2.8M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ035LA2	9.9M	0.0M	7.0M	1.4M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ035LA3	20.7M	0.0M	15.5M	3.8M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ035LA4	16.2M	0.0M	11.4M	3.2M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ035LA5	17.3M	0.0M	12.0M	3.0M	0.0M	2.1M	1.0M	1.1M	1.9M	0.2M
RZZ035LA6	12.8M	0.0M	9.0M	2.3M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ074HA1	15.8M	0.0M	11.0M	3.2M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ074HA2	19.2M	0.0M	13.2M	4.1M	0.0M	1.7M	0.8M	0.9M	1.6M	0.1M
RZZ074HA3	12.4M	0.0M	8.7M	2.8M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
RZZ074HA4	19.0M	0.0M	13.7M	3.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ074HA5	17.1M	0.0M	12.3M	2.8M	0.0M	1.8M	0.9M	0.9M	1.6M	0.2M
RZZ074HA6	16.4M	0.0M	11.5M	3.3M	0.0M	1.5M	0.7M	0.7M	1.3M	0.1M
RZZ074LA1	18.5M	0.0M	13.4M	3.7M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ074LA2	18.1M	0.0M	13.8M	2.8M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ074LA3	17.2M	0.0M	11.7M	3.4M	0.0M	1.9M	0.9M	1.0M	1.7M	0.1M
RZZ074LA4	16.0M	0.0M	10.7M	3.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ074LA5	17.8M	0.0M	13.5M	2.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ074LA6	1.0M	0.0M	0.6M	0.1M	0.0M	0.3M	0.1M	0.1M	0.2M	0.0M
RZZ075HA1	16.5M	0.0M	11.1M	3.5M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ075HA2	14.2M	0.0M	10.7M	2.0M	0.0M	1.4M	0.7M	0.7M	1.2M	0.1M
RZZ075HA3	14.8M	0.0M	10.7M	2.9M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
RZZ075HA4	17.0M	0.0M	12.2M	3.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ075HA5	14.1M	0.0M	10.4M	2.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ075HA6	15.7M	0.0M	10.9M	3.1M	0.0M	1.6M	0.8M	0.8M	1.4M	0.1M
RZZ075LA1	15.0M	0.0M	9.4M	3.7M	0.0M	1.7M	0.8M	0.9M	1.6M	0.1M
RZZ075LA2	9.2M	0.0M	6.3M	1.6M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ075LA3	16.6M	0.0M	12.0M	2.8M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ075LA4	14.6M	0.0M	10.2M	2.8M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ075LA5	21.2M	0.0M	15.3M	3.6M	0.0M	2.1M	1.0M	1.1M	1.9M	0.2M
RZZ075LA6	13.6M	0.0M	10.0M	2.3M	0.0M	1.1M	0.6M	0.6M	1.0M	0.1M
RZZ076HA1	15.2M	0.0M	10.9M	2.8M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ076HA2	16.4M	0.0M	12.3M	2.6M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ076HA3	14.6M	0.0M	10.1M	3.0M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ076HA4	18.0M	0.0M	13.8M	3.1M	0.0M	1.0M	0.5M	0.5M	0.9M	0.1M
RZZ076HA5	19.1M	0.0M	14.4M	2.8M	0.0M	1.7M	0.8M	0.9M	1.6M	0.2M
RZZ076HA6	15.3M	0.0M	10.8M	3.1M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ076LA1	14.4M	0.0M	10.1M	2.8M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ076LA2	13.6M	0.0M	9.3M	2.6M	0.0M	1.6M	0.7M	0.8M	1.4M	0.1M
RZZ076LA3	14.9M	0.0M	10.6M	2.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ076LA4	16.6M	0.0M	12.0M	3.1M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ076LA5	14.4M	0.0M	8.0M	4.6M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ076LA6	18.9M	0.0M	13.4M	3.6M	0.0M	1.7M	0.8M	0.9M	1.5M	0.1M
RZZ996HA1	12.3M	0.0M	7.9M	2.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ996HA2	14.2M	0.0M	10.4M	2.0M	0.0M	1.7M	0.8M	0.9M	1.5M	0.1M
RZZ996HA3	13.8M	0.0M	9.2M	3.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ996HA4	17.3M	0.0M	12.3M	3.5M	0.0M	1.4M	0.7M	0.7M	1.2M	0.1M
RZZ996HA5	18.2M	0.0M	13.9M	2.6M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ996HA6	16.8M	0.0M	11.2M	3.9M	0.0M	1.5M	0.7M	0.7M	1.3M	0.1M
RZZ996LA1	16.7M	0.0M	12.1M	3.0M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ996LA2	16.3M	0.0M	11.7M	3.1M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ996LA3	14.9M	0.0M	10.3M	3.0M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ996LA4	17.8M	0.0M	12.0M	3.8M	0.0M	1.8M	0.9M	0.9M	1.6M	0.1M
RZZ996LA5	16.7M	0.0M	12.2M	3.0M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ996LA6	22.3M	0.0M	16.6M	4.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ997HA1	19.0M	0.0M	13.6M	3.7M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ997HA2	16.3M	0.0M	11.9M	2.6M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ997HA3	18.7M	0.0M	13.4M	3.5M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ997HA4	21.9M	0.0M	16.1M	4.0M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ997HA5	21.8M	0.0M	15.3M	4.2M	0.0M	2.1M	1.0M	1.1M	1.9M	0.2M
RZZ997HA6	14.9M	0.0M	10.7M	2.9M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ997LA1	16.3M	0.0M	12.0M	2.8M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ997LA2	18.1M	0.0M	13.7M	2.4M	0.0M	1.8M	0.9M	0.9M	1.6M	0.2M
RZZ997LA3	14.4M	0.0M	10.0M	2.9M	0.0M	1.3M	0.6M	0.7M	1.2M	0.1M
RZZ997LA4	16.6M	0.0M	11.8M	3.1M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ997LA5	17.6M	0.0M	13.0M	3.0M	0.0M	1.5M	0.7M	0.8M	1.4M	0.1M
RZZ997LA6	9.0M	0.0M	6.1M	1.6M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ999ZA1	15.0M	0.0M	10.4M	3.0M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ999ZA2	11.5M	0.0M	8.3M	1.7M	0.0M	1.4M	0.7M	0.7M	1.3M	0.1M
RZZ999ZA3	16.9M	0.0M	12.2M	3.3M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ999ZA4	20.6M	0.0M	15.1M	3.7M	0.0M	1.6M	0.8M	0.8M	1.5M	0.1M
RZZ999ZA5	20.5M	0.0M	15.4M	3.1M	0.0M	1.8M	0.9M	0.9M	1.6M	0.2M
RZZ999ZA6	22.0M	0.0M	15.8M	4.3M	0.0M	1.7M	0.8M	0.9M	1.5M	0.1M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: rseqc_bam_stat_table

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non_splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count

Samtools

Toolkit for interacting with BAM/CRAM files.http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Percent mapped

Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.

For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.

Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).

Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.

Created with MultiQC

Alignment stats

This module parses the output from samtools stats. All numbers in millions.

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹³/₁₃ columns.

Sample Name	Total sequences	Mapped & paired	Properly paired	Duplicated	QC Failed	Reads MQ0	Mapped bases (CIGAR)	Bases Trimmed	Duplicated bases	Diff chromosomes	Other orientation	Inward pairs	Outward pairs
RZY000ZA1	17.6M	0.0M	0.0M	16.4M	0.0M	0.4M	1654.3Mb	0.0Mb	1767.7Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA2	7.9M	0.0M	0.0M	6.8M	0.0M	0.3M	716.4Mb	0.0Mb	712.6Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA3	8.9M	0.0M	0.0M	7.7M	0.0M	0.3M	799.8Mb	0.0Mb	797.5Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA4	10.8M	0.0M	0.0M	9.3M	0.0M	0.3M	959.7Mb	0.0Mb	967.3Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA5	8.9M	0.0M	0.0M	7.4M	0.0M	0.2M	833.8Mb	0.0Mb	798.8Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA6	8.8M	0.0M	0.0M	7.6M	0.0M	0.3M	805.9Mb	0.0Mb	799.1Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA1	8.2M	0.0M	0.0M	6.8M	0.0M	0.3M	741.0Mb	0.0Mb	701.5Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA2	7.6M	0.0M	0.0M	6.3M	0.0M	0.2M	690.8Mb	0.0Mb	656.6Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA3	10.6M	0.0M	0.0M	9.2M	0.0M	0.3M	951.9Mb	0.0Mb	954.7Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA4	11.7M	0.0M	0.0M	9.9M	0.0M	0.3M	1113.1Mb	0.0Mb	1075.1Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA5	9.6M	0.0M	0.0M	8.2M	0.0M	0.2M	897.8Mb	0.0Mb	873.2Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA6	10.1M	0.0M	0.0M	8.7M	0.0M	0.3M	925.3Mb	0.0Mb	915.7Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA1	8.2M	0.0M	0.0M	7.3M	0.0M	0.3M	725.1Mb	0.0Mb	740.1Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA2	13.8M	0.0M	0.0M	12.1M	0.0M	0.4M	1218.2Mb	0.0Mb	1251.4Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA3	11.8M	0.0M	0.0M	10.2M	0.0M	0.4M	1073.1Mb	0.0Mb	1072.5Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA4	11.2M	0.0M	0.0M	9.8M	0.0M	0.3M	996.5Mb	0.0Mb	1006.8Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA5	11.5M	0.0M	0.0M	10.1M	0.0M	0.3M	1073.3Mb	0.0Mb	1079.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA6	9.8M	0.0M	0.0M	8.4M	0.0M	0.2M	921.2Mb	0.0Mb	903.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA1	20.8M	0.0M	0.0M	19.4M	0.0M	0.6M	1890.3Mb	0.0Mb	2038.3Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA2	9.1M	0.0M	0.0M	8.1M	0.0M	0.3M	838.2Mb	0.0Mb	857.6Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA3	8.5M	0.0M	0.0M	7.1M	0.0M	0.2M	761.3Mb	0.0Mb	737.3Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA4	9.0M	0.0M	0.0M	7.8M	0.0M	0.3M	793.3Mb	0.0Mb	789.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA5	10.7M	0.0M	0.0M	9.4M	0.0M	0.3M	1001.1Mb	0.0Mb	998.4Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA6	10.3M	0.0M	0.0M	8.9M	0.0M	0.3M	921.1Mb	0.0Mb	918.2Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA1	12.6M	0.0M	0.0M	11.6M	0.0M	0.5M	956.4Mb	0.0Mb	1057.6Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA2	9.6M	0.0M	0.0M	8.2M	0.0M	0.3M	870.0Mb	0.0Mb	851.5Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA3	9.3M	0.0M	0.0M	8.0M	0.0M	0.3M	856.7Mb	0.0Mb	846.3Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA4	9.6M	0.0M	0.0M	8.2M	0.0M	0.3M	884.2Mb	0.0Mb	865.7Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA5	8.9M	0.0M	0.0M	7.7M	0.0M	0.2M	794.4Mb	0.0Mb	789.2Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA6	9.2M	0.0M	0.0M	8.0M	0.0M	0.2M	834.5Mb	0.0Mb	832.5Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA1	22.0M	0.0M	0.0M	20.4M	0.0M	0.8M	1974.2Mb	0.0Mb	2115.9Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA2	6.3M	0.0M	0.0M	5.3M	0.0M	0.2M	579.5Mb	0.0Mb	555.3Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA3	10.0M	0.0M	0.0M	8.6M	0.0M	0.3M	909.9Mb	0.0Mb	904.5Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA4	10.0M	0.0M	0.0M	8.7M	0.0M	0.3M	899.2Mb	0.0Mb	909.8Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA5	8.8M	0.0M	0.0M	7.5M	0.0M	0.2M	799.2Mb	0.0Mb	778.6Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA6	9.5M	0.0M	0.0M	8.2M	0.0M	0.2M	858.1Mb	0.0Mb	856.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA1	11.2M	0.0M	0.0M	9.9M	0.0M	0.2M	1129.3Mb	0.0Mb	1127.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA2	7.9M	0.0M	0.0M	7.3M	0.0M	0.1M	766.7Mb	0.0Mb	801.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA3	13.5M	0.0M	0.0M	11.9M	0.0M	0.2M	1349.8Mb	0.0Mb	1350.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA4	17.2M	0.0M	0.0M	15.1M	0.0M	0.3M	1703.2Mb	0.0Mb	1704.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA5	20.2M	0.0M	0.0M	17.9M	0.0M	0.3M	2070.6Mb	0.0Mb	2065.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA6	14.0M	0.0M	0.0M	12.5M	0.0M	0.3M	1252.7Mb	0.0Mb	1290.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA1	12.2M	0.0M	0.0M	11.0M	0.0M	0.2M	1225.0Mb	0.0Mb	1244.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA2	14.5M	0.0M	0.0M	13.1M	0.0M	0.2M	1397.1Mb	0.0Mb	1434.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA3	12.1M	0.0M	0.0M	10.3M	0.0M	0.3M	1106.9Mb	0.0Mb	1085.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA4	16.1M	0.0M	0.0M	14.5M	0.0M	0.3M	1547.4Mb	0.0Mb	1579.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA5	14.0M	0.0M	0.0M	12.5M	0.0M	0.2M	1395.1Mb	0.0Mb	1423.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA6	15.5M	0.0M	0.0M	13.7M	0.0M	0.3M	1484.0Mb	0.0Mb	1490.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA1	14.2M	0.0M	0.0M	12.5M	0.0M	0.3M	1398.0Mb	0.0Mb	1392.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA2	15.2M	0.0M	0.0M	13.6M	0.0M	0.2M	1489.0Mb	0.0Mb	1510.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA3	14.5M	0.0M	0.0M	13.0M	0.0M	0.3M	1428.3Mb	0.0Mb	1456.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA4	13.1M	0.0M	0.0M	11.7M	0.0M	0.2M	1262.7Mb	0.0Mb	1278.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA5	15.2M	0.0M	0.0M	13.2M	0.0M	0.2M	1593.7Mb	0.0Mb	1539.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA6	11.3M	0.0M	0.0M	9.8M	0.0M	0.1M	1229.1Mb	0.0Mb	1186.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA1	14.2M	0.0M	0.0M	12.5M	0.0M	0.2M	1391.3Mb	0.0Mb	1397.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA2	10.8M	0.0M	0.0M	9.2M	0.0M	0.2M	1041.1Mb	0.0Mb	1010.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA3	15.3M	0.0M	0.0M	13.3M	0.0M	0.2M	1516.4Mb	0.0Mb	1502.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA4	13.2M	0.0M	0.0M	11.8M	0.0M	0.2M	1268.6Mb	0.0Mb	1299.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA5	17.9M	0.0M	0.0M	16.1M	0.0M	0.3M	1784.7Mb	0.0Mb	1824.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA6	14.4M	0.0M	0.0M	13.0M	0.0M	0.4M	1211.6Mb	0.0Mb	1284.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA1	13.7M	0.0M	0.0M	11.8M	0.0M	0.3M	1347.9Mb	0.0Mb	1311.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA2	14.6M	0.0M	0.0M	12.6M	0.0M	0.2M	1462.8Mb	0.0Mb	1412.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA3	12.2M	0.0M	0.0M	10.9M	0.0M	0.2M	1197.3Mb	0.0Mb	1213.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA4	14.1M	0.0M	0.0M	12.5M	0.0M	0.3M	1319.8Mb	0.0Mb	1338.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA5	16.5M	0.0M	0.0M	14.3M	0.0M	0.3M	1551.2Mb	0.0Mb	1547.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA6	15.3M	0.0M	0.0M	13.6M	0.0M	0.3M	1455.6Mb	0.0Mb	1484.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA1	14.6M	0.0M	0.0M	13.1M	0.0M	0.2M	1455.1Mb	0.0Mb	1485.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA2	16.2M	0.0M	0.0M	14.5M	0.0M	0.3M	1524.5Mb	0.0Mb	1564.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA3	15.0M	0.0M	0.0M	13.5M	0.0M	0.3M	1444.8Mb	0.0Mb	1488.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA4	13.0M	0.0M	0.0M	11.6M	0.0M	0.3M	1191.8Mb	0.0Mb	1224.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA5	13.0M	0.0M	0.0M	11.2M	0.0M	0.4M	1113.6Mb	0.0Mb	1118.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA6	11.9M	0.0M	0.0M	10.8M	0.0M	0.2M	1119.2Mb	0.0Mb	1175.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA1	11.9M	0.0M	0.0M	9.9M	0.0M	0.3M	1073.9Mb	0.0Mb	1034.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA2	12.4M	0.0M	0.0M	10.7M	0.0M	0.2M	1238.9Mb	0.0Mb	1208.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA3	16.0M	0.0M	0.0M	14.2M	0.0M	0.3M	1576.2Mb	0.0Mb	1602.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA4	15.8M	0.0M	0.0M	13.9M	0.0M	0.3M	1512.9Mb	0.0Mb	1519.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA5	13.6M	0.0M	0.0M	12.1M	0.0M	0.2M	1370.1Mb	0.0Mb	1379.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA6	13.4M	0.0M	0.0M	11.8M	0.0M	0.2M	1331.2Mb	0.0Mb	1317.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA1	13.8M	0.0M	0.0M	12.5M	0.0M	0.3M	1361.2Mb	0.0Mb	1405.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA2	18.0M	0.0M	0.0M	16.4M	0.0M	0.3M	1667.6Mb	0.0Mb	1751.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA3	14.7M	0.0M	0.0M	13.2M	0.0M	0.3M	1387.0Mb	0.0Mb	1443.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA4	14.1M	0.0M	0.0M	12.2M	0.0M	0.3M	1265.2Mb	0.0Mb	1268.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA5	12.7M	0.0M	0.0M	11.5M	0.0M	0.2M	1290.6Mb	0.0Mb	1319.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA6	13.0M	0.0M	0.0M	12.0M	0.0M	0.2M	1264.5Mb	0.0Mb	1316.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA1	13.5M	0.0M	0.0M	12.0M	0.0M	0.3M	1321.0Mb	0.0Mb	1332.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA2	13.4M	0.0M	0.0M	11.8M	0.0M	0.2M	1331.7Mb	0.0Mb	1328.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA3	14.0M	0.0M	0.0M	12.4M	0.0M	0.3M	1362.3Mb	0.0Mb	1376.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA4	12.1M	0.0M	0.0M	10.6M	0.0M	0.2M	1157.6Mb	0.0Mb	1149.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA5	13.6M	0.0M	0.0M	12.1M	0.0M	0.2M	1401.2Mb	0.0Mb	1391.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA6	14.3M	0.0M	0.0M	13.1M	0.0M	0.1M	1702.4Mb	0.0Mb	1677.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA1	12.2M	0.0M	0.0M	10.5M	0.0M	0.3M	1182.2Mb	0.0Mb	1161.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA2	14.3M	0.0M	0.0M	12.4M	0.0M	0.2M	1386.2Mb	0.0Mb	1364.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA3	17.3M	0.0M	0.0M	15.4M	0.0M	0.3M	1717.1Mb	0.0Mb	1730.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA4	15.0M	0.0M	0.0M	13.1M	0.0M	0.2M	1486.0Mb	0.0Mb	1463.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA5	11.8M	0.0M	0.0M	9.9M	0.0M	0.2M	1151.2Mb	0.0Mb	1101.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA6	17.1M	0.0M	0.0M	15.5M	0.0M	0.3M	1668.4Mb	0.0Mb	1712.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA1	12.0M	0.0M	0.0M	10.7M	0.0M	0.2M	1227.6Mb	0.0Mb	1232.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA2	18.5M	0.0M	0.0M	16.1M	0.0M	0.4M	1667.9Mb	0.0Mb	1670.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA3	11.7M	0.0M	0.0M	10.5M	0.0M	0.2M	1162.4Mb	0.0Mb	1193.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA4	15.0M	0.0M	0.0M	13.4M	0.0M	0.3M	1416.4Mb	0.0Mb	1449.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA5	11.7M	0.0M	0.0M	10.1M	0.0M	0.2M	1195.9Mb	0.0Mb	1160.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA6	16.0M	0.0M	0.0M	14.4M	0.0M	0.3M	1534.3Mb	0.0Mb	1566.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA1	10.3M	0.0M	0.0M	9.1M	0.0M	0.2M	1038.6Mb	0.0Mb	1033.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA2	11.5M	0.0M	0.0M	10.2M	0.0M	0.2M	1116.5Mb	0.0Mb	1122.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA3	12.8M	0.0M	0.0M	10.6M	0.0M	0.3M	1229.9Mb	0.0Mb	1168.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA4	13.7M	0.0M	0.0M	12.3M	0.0M	0.2M	1333.6Mb	0.0Mb	1364.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA5	8.1M	0.0M	0.0M	7.0M	0.0M	0.2M	807.3Mb	0.0Mb	793.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA6	12.6M	0.0M	0.0M	11.0M	0.0M	0.2M	1203.9Mb	0.0Mb	1197.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA1	10.6M	0.0M	0.0M	8.9M	0.0M	0.3M	977.7Mb	0.0Mb	943.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA2	7.2M	0.0M	0.0M	5.9M	0.0M	0.1M	699.5Mb	0.0Mb	649.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA3	12.6M	0.0M	0.0M	10.7M	0.0M	0.2M	1238.1Mb	0.0Mb	1197.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA4	17.6M	0.0M	0.0M	15.7M	0.0M	0.3M	1672.7Mb	0.0Mb	1702.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA5	17.8M	0.0M	0.0M	15.7M	0.0M	0.2M	1835.7Mb	0.0Mb	1828.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA6	9.1M	0.0M	0.0M	7.5M	0.0M	0.1M	885.3Mb	0.0Mb	828.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA1	14.2M	0.0M	0.0M	12.6M	0.0M	0.3M	1387.9Mb	0.0Mb	1398.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA2	12.0M	0.0M	0.0M	10.2M	0.0M	0.2M	1163.2Mb	0.0Mb	1124.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA3	13.3M	0.0M	0.0M	11.6M	0.0M	0.3M	1295.7Mb	0.0Mb	1284.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA4	10.6M	0.0M	0.0M	9.8M	0.0M	0.2M	1004.5Mb	0.0Mb	1058.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA5	16.0M	0.0M	0.0M	14.3M	0.0M	0.2M	1610.4Mb	0.0Mb	1623.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA6	12.6M	0.0M	0.0M	11.0M	0.0M	0.2M	1231.9Mb	0.0Mb	1224.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA1	12.2M	0.0M	0.0M	10.6M	0.0M	0.2M	1209.0Mb	0.0Mb	1198.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA2	8.5M	0.0M	0.0M	7.0M	0.0M	0.1M	846.6Mb	0.0Mb	789.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA3	17.0M	0.0M	0.0M	15.5M	0.0M	0.3M	1672.0Mb	0.0Mb	1745.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA4	13.0M	0.0M	0.0M	11.4M	0.0M	0.2M	1210.5Mb	0.0Mb	1216.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA5	14.3M	0.0M	0.0M	12.0M	0.0M	0.3M	1371.5Mb	0.0Mb	1320.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA6	10.5M	0.0M	0.0M	9.0M	0.0M	0.2M	1002.5Mb	0.0Mb	966.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA1	12.7M	0.0M	0.0M	11.0M	0.0M	0.2M	1250.1Mb	0.0Mb	1235.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA2	15.1M	0.0M	0.0M	13.2M	0.0M	0.3M	1392.2Mb	0.0Mb	1393.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA3	9.6M	0.0M	0.0M	8.7M	0.0M	0.2M	919.0Mb	0.0Mb	951.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA4	15.3M	0.0M	0.0M	13.7M	0.0M	0.3M	1407.3Mb	0.0Mb	1451.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA5	14.3M	0.0M	0.0M	12.3M	0.0M	0.2M	1435.5Mb	0.0Mb	1401.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA6	13.1M	0.0M	0.0M	11.5M	0.0M	0.2M	1240.8Mb	0.0Mb	1247.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA1	14.8M	0.0M	0.0M	13.4M	0.0M	0.3M	1436.2Mb	0.0Mb	1494.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA2	15.2M	0.0M	0.0M	13.8M	0.0M	0.2M	1499.5Mb	0.0Mb	1540.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA3	13.7M	0.0M	0.0M	11.7M	0.0M	0.3M	1349.9Mb	0.0Mb	1306.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA4	12.3M	0.0M	0.0M	10.7M	0.0M	0.3M	1130.9Mb	0.0Mb	1130.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA5	14.9M	0.0M	0.0M	13.5M	0.0M	0.2M	1483.0Mb	0.0Mb	1530.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA6	0.9M	0.0M	0.0M	0.6M	0.0M	0.0M	114.5Mb	0.0Mb	84.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA1	12.9M	0.0M	0.0M	11.1M	0.0M	0.3M	1231.0Mb	0.0Mb	1218.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA2	12.2M	0.0M	0.0M	10.7M	0.0M	0.2M	1236.1Mb	0.0Mb	1221.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA3	11.9M	0.0M	0.0M	10.7M	0.0M	0.2M	1171.6Mb	0.0Mb	1201.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA4	13.6M	0.0M	0.0M	12.2M	0.0M	0.3M	1242.2Mb	0.0Mb	1293.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA5	11.7M	0.0M	0.0M	10.4M	0.0M	0.2M	1157.4Mb	0.0Mb	1164.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA6	12.6M	0.0M	0.0M	10.9M	0.0M	0.2M	1174.5Mb	0.0Mb	1161.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA1	11.3M	0.0M	0.0M	9.4M	0.0M	0.3M	1030.5Mb	0.0Mb	988.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA2	7.7M	0.0M	0.0M	6.3M	0.0M	0.1M	760.8Mb	0.0Mb	706.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA3	13.8M	0.0M	0.0M	12.0M	0.0M	0.2M	1375.5Mb	0.0Mb	1356.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA4	11.8M	0.0M	0.0M	10.2M	0.0M	0.2M	1147.1Mb	0.0Mb	1127.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA5	17.6M	0.0M	0.0M	15.3M	0.0M	0.3M	1635.6Mb	0.0Mb	1638.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA6	11.3M	0.0M	0.0M	10.0M	0.0M	0.2M	1111.1Mb	0.0Mb	1115.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA1	12.4M	0.0M	0.0M	10.9M	0.0M	0.2M	1239.6Mb	0.0Mb	1236.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA2	13.8M	0.0M	0.0M	12.3M	0.0M	0.2M	1330.9Mb	0.0Mb	1350.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA3	11.6M	0.0M	0.0M	10.1M	0.0M	0.2M	1113.5Mb	0.0Mb	1109.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA4	14.9M	0.0M	0.0M	13.8M	0.0M	0.2M	1412.5Mb	0.0Mb	1490.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA5	16.3M	0.0M	0.0M	14.4M	0.0M	0.2M	1631.4Mb	0.0Mb	1630.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA6	12.2M	0.0M	0.0M	10.8M	0.0M	0.2M	1149.8Mb	0.0Mb	1167.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA1	11.6M	0.0M	0.0M	10.1M	0.0M	0.2M	1124.9Mb	0.0Mb	1121.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA2	11.0M	0.0M	0.0M	9.3M	0.0M	0.2M	1064.8Mb	0.0Mb	1016.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA3	12.2M	0.0M	0.0M	10.6M	0.0M	0.2M	1198.7Mb	0.0Mb	1181.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA4	13.5M	0.0M	0.0M	12.0M	0.0M	0.2M	1296.2Mb	0.0Mb	1311.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA5	9.8M	0.0M	0.0M	8.0M	0.0M	0.4M	732.6Mb	0.0Mb	724.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA6	15.3M	0.0M	0.0M	13.4M	0.0M	0.3M	1452.5Mb	0.0Mb	1455.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA1	9.5M	0.0M	0.0M	7.9M	0.0M	0.2M	894.2Mb	0.0Mb	853.2Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA2	12.2M	0.0M	0.0M	10.4M	0.0M	0.2M	1209.3Mb	0.0Mb	1159.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA3	10.5M	0.0M	0.0M	9.2M	0.0M	0.3M	992.3Mb	0.0Mb	984.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA4	13.8M	0.0M	0.0M	12.3M	0.0M	0.3M	1318.7Mb	0.0Mb	1340.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA5	15.6M	0.0M	0.0M	13.9M	0.0M	0.2M	1594.9Mb	0.0Mb	1611.6Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA6	12.9M	0.0M	0.0M	11.2M	0.0M	0.3M	1160.4Mb	0.0Mb	1160.8Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA1	13.7M	0.0M	0.0M	12.1M	0.0M	0.2M	1349.8Mb	0.0Mb	1352.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA2	13.2M	0.0M	0.0M	11.7M	0.0M	0.2M	1293.8Mb	0.0Mb	1306.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA3	12.0M	0.0M	0.0M	10.3M	0.0M	0.2M	1151.3Mb	0.0Mb	1136.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA4	14.0M	0.0M	0.0M	12.0M	0.0M	0.3M	1292.5Mb	0.0Mb	1275.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA5	13.7M	0.0M	0.0M	12.2M	0.0M	0.2M	1352.0Mb	0.0Mb	1362.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA6	17.9M	0.0M	0.0M	16.6M	0.0M	0.4M	1675.6Mb	0.0Mb	1781.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA1	15.3M	0.0M	0.0M	13.6M	0.0M	0.3M	1496.3Mb	0.0Mb	1517.7Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA2	13.7M	0.0M	0.0M	11.9M	0.0M	0.2M	1328.0Mb	0.0Mb	1309.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA3	15.2M	0.0M	0.0M	13.4M	0.0M	0.3M	1489.2Mb	0.0Mb	1506.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA4	17.9M	0.0M	0.0M	16.1M	0.0M	0.3M	1695.8Mb	0.0Mb	1750.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA5	17.6M	0.0M	0.0M	15.3M	0.0M	0.3M	1701.7Mb	0.0Mb	1698.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA6	12.0M	0.0M	0.0M	10.7M	0.0M	0.2M	1148.7Mb	0.0Mb	1160.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA1	13.5M	0.0M	0.0M	12.0M	0.0M	0.2M	1348.3Mb	0.0Mb	1356.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA2	15.7M	0.0M	0.0M	13.7M	0.0M	0.2M	1586.4Mb	0.0Mb	1555.3Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA3	11.5M	0.0M	0.0M	10.0M	0.0M	0.2M	1108.2Mb	0.0Mb	1102.1Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA4	13.5M	0.0M	0.0M	11.8M	0.0M	0.2M	1297.2Mb	0.0Mb	1287.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA5	14.6M	0.0M	0.0M	13.0M	0.0M	0.2M	1467.4Mb	0.0Mb	1473.5Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA6	7.4M	0.0M	0.0M	6.1M	0.0M	0.1M	720.7Mb	0.0Mb	670.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA1	12.0M	0.0M	0.0M	10.4M	0.0M	0.3M	1171.2Mb	0.0Mb	1161.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA2	9.9M	0.0M	0.0M	8.3M	0.0M	0.1M	990.1Mb	0.0Mb	934.4Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA3	13.6M	0.0M	0.0M	12.2M	0.0M	0.3M	1341.0Mb	0.0Mb	1372.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA4	16.9M	0.0M	0.0M	15.1M	0.0M	0.3M	1629.4Mb	0.0Mb	1655.9Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA5	17.4M	0.0M	0.0M	15.4M	0.0M	0.2M	1786.9Mb	0.0Mb	1780.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA6	17.7M	0.0M	0.0M	15.8M	0.0M	0.3M	1691.9Mb	0.0Mb	1735.0Mb	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-stats-dp_table

Sort	Column	Description	ID	Scale
\|\|	Total sequences	Total sequences	`raw_total_sequences`	read_count
\|\|	Mapped & paired	Paired-end technology bit set + both mates mapped	`reads_mapped_and_paired`	read_count
\|\|	Properly paired	Proper-pair bit set	`reads_properly_paired`	read_count
\|\|	Duplicated	PCR or optical duplicate bit set	`reads_duplicated`	read_count
\|\|	QC Failed	QC Failed	`reads_QC_failed`	read_count
\|\|	Reads MQ0	Reads mapped and MQ=0	`reads_MQ0`	read_count
\|\|	Mapped bases (CIGAR)	Mapped bases (CIGAR)	`bases_mapped__cigar`	base_count
\|\|	Bases Trimmed	Bases Trimmed	`bases_trimmed`	base_count
\|\|	Duplicated bases	Duplicated bases	`bases_duplicated`	base_count
\|\|	Diff chromosomes	Pairs on different chromosomes	`pairs_on_different_chromosomes`	read_count
\|\|	Other orientation	Pairs with other orientation	`pairs_with_other_orientation`	read_count
\|\|	Inward pairs	Inward oriented pairs	`inward_oriented_pairs`	read_count
\|\|	Outward pairs	Outward oriented pairs	`outward_oriented_pairs`	read_count

Flagstat

This module parses the output from samtools flagstat

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
RZY000ZA1	23.0M	23.0M	23.0M	5.4M	16.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA2	11.2M	11.2M	11.2M	3.3M	6.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA3	12.4M	12.4M	12.4M	3.5M	7.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA4	14.6M	14.6M	14.6M	3.8M	9.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA5	11.6M	11.6M	11.6M	2.7M	7.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA6	11.8M	11.8M	11.8M	3.0M	7.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA1	11.6M	11.6M	11.6M	3.4M	6.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA2	10.6M	10.6M	10.6M	2.9M	6.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA3	14.5M	14.5M	14.5M	3.9M	9.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA4	15.3M	15.3M	15.3M	3.6M	9.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA5	12.5M	12.5M	12.5M	2.9M	8.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA6	13.3M	13.3M	13.3M	3.1M	8.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA1	11.5M	11.5M	11.5M	3.3M	7.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA2	19.2M	19.2M	19.2M	5.4M	12.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA3	16.0M	16.0M	16.0M	4.2M	10.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA4	15.1M	15.1M	15.1M	3.9M	9.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA5	15.0M	15.0M	15.0M	3.5M	10.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA6	12.6M	12.6M	12.6M	2.8M	8.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA1	28.5M	28.5M	28.5M	7.7M	19.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA2	12.5M	12.5M	12.5M	3.4M	8.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA3	11.4M	11.4M	11.4M	2.9M	7.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA4	12.8M	12.8M	12.8M	3.8M	7.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA5	14.0M	14.0M	14.0M	3.3M	9.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA6	13.8M	13.8M	13.8M	3.5M	8.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA1	18.6M	18.6M	18.6M	6.0M	11.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA2	12.7M	12.7M	12.7M	3.1M	8.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA3	12.4M	12.4M	12.4M	3.1M	8.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA4	13.0M	13.0M	13.0M	3.4M	8.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA5	11.9M	11.9M	11.9M	3.0M	7.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA6	12.0M	12.0M	12.0M	2.8M	8.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA1	31.4M	31.4M	31.4M	9.5M	20.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA2	8.5M	8.5M	8.5M	2.2M	5.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA3	13.8M	13.8M	13.8M	3.8M	8.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA4	14.0M	14.0M	14.0M	4.0M	8.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA5	11.8M	11.8M	11.8M	3.0M	7.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA6	12.4M	12.4M	12.4M	3.0M	8.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA1	13.9M	13.9M	13.9M	2.7M	9.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA2	9.1M	9.1M	9.1M	1.2M	7.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA3	16.4M	16.4M	16.4M	2.9M	11.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA4	20.7M	20.7M	20.7M	3.5M	15.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA5	23.9M	23.9M	23.9M	3.6M	17.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA6	17.7M	17.7M	17.7M	3.7M	12.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA1	14.8M	14.8M	14.8M	2.6M	11.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA2	16.8M	16.8M	16.8M	2.2M	13.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA3	15.6M	15.6M	15.6M	3.5M	10.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA4	19.8M	19.8M	19.8M	3.7M	14.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA5	16.5M	16.5M	16.5M	2.5M	12.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA6	19.3M	19.3M	19.3M	3.8M	13.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA1	17.9M	17.9M	17.9M	3.6M	12.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA2	17.9M	17.9M	17.9M	2.7M	13.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA3	17.9M	17.9M	17.9M	3.4M	13.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA4	16.3M	16.3M	16.3M	3.1M	11.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA5	17.6M	17.6M	17.6M	2.4M	13.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA6	13.1M	13.1M	13.1M	1.8M	9.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA1	17.4M	17.4M	17.4M	3.1M	12.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA2	12.9M	12.9M	12.9M	2.1M	9.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA3	18.6M	18.6M	18.6M	3.2M	13.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA4	16.3M	16.3M	16.3M	3.1M	11.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA5	21.6M	21.6M	21.6M	3.7M	16.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA6	18.5M	18.5M	18.5M	4.1M	13.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA1	17.0M	17.0M	17.0M	3.2M	11.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA2	16.9M	16.9M	16.9M	2.3M	12.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA3	15.0M	15.0M	15.0M	2.8M	10.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA4	17.7M	17.7M	17.7M	3.6M	12.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA5	20.7M	20.7M	20.7M	4.2M	14.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA6	18.9M	18.9M	18.9M	3.6M	13.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA1	17.8M	17.8M	17.8M	3.1M	13.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA2	19.6M	19.6M	19.6M	3.5M	14.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA3	18.6M	18.6M	18.6M	3.6M	13.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA4	16.4M	16.4M	16.4M	3.4M	11.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA5	18.0M	18.0M	18.0M	5.0M	11.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA6	14.9M	14.9M	14.9M	3.0M	10.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA1	15.5M	15.5M	15.5M	3.6M	9.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA2	14.5M	14.5M	14.5M	2.1M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA3	19.8M	19.8M	19.8M	3.7M	14.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA4	19.2M	19.2M	19.2M	3.4M	13.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA5	16.2M	16.2M	16.2M	2.5M	12.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA6	16.1M	16.1M	16.1M	2.7M	11.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA1	17.2M	17.2M	17.2M	3.4M	12.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA2	22.2M	22.2M	22.2M	4.3M	16.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA3	18.8M	18.8M	18.8M	4.1M	13.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA4	18.1M	18.1M	18.1M	4.0M	12.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA5	15.2M	15.2M	15.2M	2.5M	11.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA6	16.2M	16.2M	16.2M	3.2M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA1	17.0M	17.0M	17.0M	3.4M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA2	15.8M	15.8M	15.8M	2.4M	11.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA3	17.2M	17.2M	17.2M	3.2M	12.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA4	14.8M	14.8M	14.8M	2.7M	10.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA5	16.0M	16.0M	16.0M	2.4M	12.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA6	16.1M	16.1M	16.1M	1.8M	13.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA1	15.6M	15.6M	15.6M	3.4M	10.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA2	16.9M	16.9M	16.9M	2.7M	12.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA3	21.2M	21.2M	21.2M	3.9M	15.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA4	18.2M	18.2M	18.2M	3.1M	13.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA5	14.9M	14.9M	14.9M	3.1M	9.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA6	20.8M	20.8M	20.8M	3.7M	15.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA1	14.4M	14.4M	14.4M	2.4M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA2	23.6M	23.6M	23.6M	5.1M	16.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA3	14.4M	14.4M	14.4M	2.7M	10.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA4	18.8M	18.8M	18.8M	3.8M	13.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA5	13.9M	13.9M	13.9M	2.2M	10.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA6	19.6M	19.6M	19.6M	3.6M	14.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA1	12.9M	12.9M	12.9M	2.6M	9.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA2	13.8M	13.8M	13.8M	2.3M	10.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA3	16.1M	16.1M	16.1M	3.3M	10.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA4	17.0M	17.0M	17.0M	3.3M	12.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA5	10.1M	10.1M	10.1M	2.0M	7.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA6	16.0M	16.0M	16.0M	3.4M	11.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA1	14.1M	14.1M	14.1M	3.5M	8.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA2	8.6M	8.6M	8.6M	1.5M	5.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA3	15.8M	15.8M	15.8M	3.2M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA4	21.7M	21.7M	21.7M	4.1M	15.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA5	20.9M	20.9M	20.9M	3.1M	15.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA6	11.0M	11.0M	11.0M	1.9M	7.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA1	17.6M	17.6M	17.6M	3.5M	12.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA2	15.1M	15.1M	15.1M	3.2M	10.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA3	16.6M	16.6M	16.6M	3.2M	11.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA4	13.2M	13.2M	13.2M	2.6M	9.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA5	19.1M	19.1M	19.1M	3.2M	14.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA6	15.5M	15.5M	15.5M	2.8M	11.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA1	15.0M	15.0M	15.0M	2.8M	10.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA2	9.9M	9.9M	9.9M	1.4M	7.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA3	20.7M	20.7M	20.7M	3.8M	15.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA4	16.2M	16.2M	16.2M	3.2M	11.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA5	17.3M	17.3M	17.3M	3.0M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA6	12.8M	12.8M	12.8M	2.3M	9.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA1	15.8M	15.8M	15.8M	3.2M	11.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA2	19.2M	19.2M	19.2M	4.1M	13.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA3	12.4M	12.4M	12.4M	2.8M	8.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA4	19.0M	19.0M	19.0M	3.7M	13.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA5	17.1M	17.1M	17.1M	2.8M	12.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA6	16.4M	16.4M	16.4M	3.3M	11.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA1	18.5M	18.5M	18.5M	3.7M	13.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA2	18.1M	18.1M	18.1M	2.8M	13.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA3	17.2M	17.2M	17.2M	3.4M	11.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA4	16.0M	16.0M	16.0M	3.7M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA5	17.8M	17.8M	17.8M	2.9M	13.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA6	1.0M	1.0M	1.0M	0.1M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA1	16.5M	16.5M	16.5M	3.5M	11.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA2	14.2M	14.2M	14.2M	2.0M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA3	14.8M	14.8M	14.8M	2.9M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA4	17.0M	17.0M	17.0M	3.3M	12.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA5	14.1M	14.1M	14.1M	2.3M	10.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA6	15.7M	15.7M	15.7M	3.1M	10.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA1	15.0M	15.0M	15.0M	3.7M	9.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA2	9.2M	9.2M	9.2M	1.6M	6.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA3	16.6M	16.6M	16.6M	2.8M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA4	14.6M	14.6M	14.6M	2.8M	10.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA5	21.2M	21.2M	21.2M	3.6M	15.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA6	13.6M	13.6M	13.6M	2.3M	10.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA1	15.2M	15.2M	15.2M	2.8M	10.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA2	16.4M	16.4M	16.4M	2.6M	12.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA3	14.6M	14.6M	14.6M	3.0M	10.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA4	18.0M	18.0M	18.0M	3.1M	13.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA5	19.1M	19.1M	19.1M	2.8M	14.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA6	15.3M	15.3M	15.3M	3.1M	10.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA1	14.4M	14.4M	14.4M	2.8M	10.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA2	13.6M	13.6M	13.6M	2.6M	9.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA3	14.9M	14.9M	14.9M	2.7M	10.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA4	16.6M	16.6M	16.6M	3.1M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA5	14.4M	14.4M	14.4M	4.6M	8.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA6	18.9M	18.9M	18.9M	3.6M	13.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA1	12.3M	12.3M	12.3M	2.7M	7.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA2	14.2M	14.2M	14.2M	2.0M	10.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA3	13.8M	13.8M	13.8M	3.3M	9.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA4	17.3M	17.3M	17.3M	3.5M	12.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA5	18.2M	18.2M	18.2M	2.6M	13.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA6	16.8M	16.8M	16.8M	3.9M	11.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA1	16.7M	16.7M	16.7M	3.0M	12.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA2	16.3M	16.3M	16.3M	3.1M	11.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA3	14.9M	14.9M	14.9M	3.0M	10.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA4	17.8M	17.8M	17.8M	3.8M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA5	16.7M	16.7M	16.7M	3.0M	12.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA6	22.3M	22.3M	22.3M	4.3M	16.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA1	19.0M	19.0M	19.0M	3.7M	13.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA2	16.3M	16.3M	16.3M	2.6M	11.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA3	18.7M	18.7M	18.7M	3.5M	13.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA4	21.9M	21.9M	21.9M	4.0M	16.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA5	21.8M	21.8M	21.8M	4.2M	15.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA6	14.9M	14.9M	14.9M	2.9M	10.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA1	16.3M	16.3M	16.3M	2.8M	12.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA2	18.1M	18.1M	18.1M	2.4M	13.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA3	14.4M	14.4M	14.4M	2.9M	10.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA4	16.6M	16.6M	16.6M	3.1M	11.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA5	17.6M	17.6M	17.6M	3.0M	13.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA6	9.0M	9.0M	9.0M	1.6M	6.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA1	15.0M	15.0M	15.0M	3.0M	10.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA2	11.5M	11.5M	11.5M	1.7M	8.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA3	16.9M	16.9M	16.9M	3.3M	12.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA4	20.6M	20.6M	20.6M	3.7M	15.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA5	20.5M	20.5M	20.5M	3.1M	15.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA6	22.0M	22.0M	22.0M	4.3M	15.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-table_table

Sort	Column	Description	ID	Scale
\|\|	Total Reads	Total Reads	`flagstat_total`	read_count
\|\|	Total Passed QC	Total Passed QC	`total_passed`	read_count
\|\|	Mapped	Mapped	`mapped_passed`	read_count
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed`	read_count
\|\|	Duplicates	Duplicates	`duplicates_passed`	read_count
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed`	read_count
\|\|	Properly Paired	Properly Paired	`properly_paired_passed`	read_count
\|\|	Self and mate mapped	Reads with itself and mate mapped	`with_itself_and_mate_mapped_passed`	read_count
\|\|	Singletons	Singletons	`singletons_passed`	read_count
\|\|	Mate mapped to diff chr	Mate mapped to different chromosome	`with_mate_mapped_to_a_different_chr_passed`	read_count
\|\|	Diff chr (mapQ >= 5)	Mate mapped to different chromosome (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed`	read_count

Flagstat: Percentage of total

This module parses the output from samtools flagstat

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
RZY000ZA1	100.0%	100.0%	100.0%	23.3%	71.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA2	100.0%	100.0%	100.0%	29.1%	60.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA3	100.0%	100.0%	100.0%	28.2%	62.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA4	100.0%	100.0%	100.0%	26.1%	63.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA5	100.0%	100.0%	100.0%	23.5%	64.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA6	100.0%	100.0%	100.0%	25.7%	64.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA1	100.0%	100.0%	100.0%	29.4%	58.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA2	100.0%	100.0%	100.0%	27.9%	59.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA3	100.0%	100.0%	100.0%	26.9%	63.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA4	100.0%	100.0%	100.0%	23.4%	65.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA5	100.0%	100.0%	100.0%	23.1%	65.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA6	100.0%	100.0%	100.0%	23.6%	66.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA1	100.0%	100.0%	100.0%	28.8%	63.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA2	100.0%	100.0%	100.0%	28.3%	63.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA3	100.0%	100.0%	100.0%	26.4%	63.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA4	100.0%	100.0%	100.0%	25.9%	64.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA5	100.0%	100.0%	100.0%	23.4%	67.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA6	100.0%	100.0%	100.0%	22.5%	66.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA1	100.0%	100.0%	100.0%	26.9%	68.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA2	100.0%	100.0%	100.0%	27.2%	64.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA3	100.0%	100.0%	100.0%	25.8%	62.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA4	100.0%	100.0%	100.0%	29.4%	60.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA5	100.0%	100.0%	100.0%	23.4%	67.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA6	100.0%	100.0%	100.0%	25.3%	64.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA1	100.0%	100.0%	100.0%	32.3%	62.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA2	100.0%	100.0%	100.0%	24.4%	64.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA3	100.0%	100.0%	100.0%	25.1%	64.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA4	100.0%	100.0%	100.0%	26.2%	63.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA5	100.0%	100.0%	100.0%	25.0%	64.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA6	100.0%	100.0%	100.0%	23.0%	67.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA1	100.0%	100.0%	100.0%	30.1%	64.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA2	100.0%	100.0%	100.0%	26.3%	62.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA3	100.0%	100.0%	100.0%	27.4%	62.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA4	100.0%	100.0%	100.0%	28.8%	62.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA5	100.0%	100.0%	100.0%	25.1%	63.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA6	100.0%	100.0%	100.0%	23.8%	66.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA1	100.0%	100.0%	100.0%	19.6%	71.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA2	100.0%	100.0%	100.0%	13.7%	79.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA3	100.0%	100.0%	100.0%	17.7%	72.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA4	100.0%	100.0%	100.0%	16.8%	73.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA5	100.0%	100.0%	100.0%	15.3%	75.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA6	100.0%	100.0%	100.0%	21.1%	70.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA1	100.0%	100.0%	100.0%	17.3%	74.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA2	100.0%	100.0%	100.0%	13.3%	77.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA3	100.0%	100.0%	100.0%	22.6%	65.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA4	100.0%	100.0%	100.0%	18.9%	72.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA5	100.0%	100.0%	100.0%	15.1%	76.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA6	100.0%	100.0%	100.0%	19.9%	70.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA1	100.0%	100.0%	100.0%	20.3%	69.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA2	100.0%	100.0%	100.0%	15.2%	75.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA3	100.0%	100.0%	100.0%	18.9%	72.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA4	100.0%	100.0%	100.0%	19.2%	71.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA5	100.0%	100.0%	100.0%	13.8%	74.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA6	100.0%	100.0%	100.0%	13.9%	75.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA1	100.0%	100.0%	100.0%	18.0%	72.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA2	100.0%	100.0%	100.0%	16.2%	71.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA3	100.0%	100.0%	100.0%	17.4%	71.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA4	100.0%	100.0%	100.0%	18.9%	72.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA5	100.0%	100.0%	100.0%	17.1%	74.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA6	100.0%	100.0%	100.0%	22.4%	70.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA1	100.0%	100.0%	100.0%	19.1%	69.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA2	100.0%	100.0%	100.0%	13.7%	74.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA3	100.0%	100.0%	100.0%	18.7%	72.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA4	100.0%	100.0%	100.0%	20.4%	70.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA5	100.0%	100.0%	100.0%	20.4%	69.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA6	100.0%	100.0%	100.0%	19.2%	72.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA1	100.0%	100.0%	100.0%	17.6%	73.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA2	100.0%	100.0%	100.0%	17.6%	73.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA3	100.0%	100.0%	100.0%	19.5%	72.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA4	100.0%	100.0%	100.0%	20.9%	70.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA5	100.0%	100.0%	100.0%	27.8%	61.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA6	100.0%	100.0%	100.0%	20.1%	73.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA1	100.0%	100.0%	100.0%	23.4%	63.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA2	100.0%	100.0%	100.0%	14.3%	73.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA3	100.0%	100.0%	100.0%	19.0%	72.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA4	100.0%	100.0%	100.0%	17.8%	72.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA5	100.0%	100.0%	100.0%	15.5%	74.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA6	100.0%	100.0%	100.0%	16.9%	73.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA1	100.0%	100.0%	100.0%	19.8%	72.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA2	100.0%	100.0%	100.0%	19.2%	73.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA3	100.0%	100.0%	100.0%	22.0%	70.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA4	100.0%	100.0%	100.0%	21.9%	67.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA5	100.0%	100.0%	100.0%	16.2%	75.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA6	100.0%	100.0%	100.0%	19.8%	73.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA1	100.0%	100.0%	100.0%	20.3%	70.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA2	100.0%	100.0%	100.0%	15.3%	74.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA3	100.0%	100.0%	100.0%	18.7%	72.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA4	100.0%	100.0%	100.0%	18.1%	71.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA5	100.0%	100.0%	100.0%	14.9%	75.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA6	100.0%	100.0%	100.0%	10.9%	81.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA1	100.0%	100.0%	100.0%	21.7%	67.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA2	100.0%	100.0%	100.0%	15.7%	73.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA3	100.0%	100.0%	100.0%	18.4%	72.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA4	100.0%	100.0%	100.0%	17.3%	71.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA5	100.0%	100.0%	100.0%	20.7%	66.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA6	100.0%	100.0%	100.0%	17.6%	74.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA1	100.0%	100.0%	100.0%	16.4%	74.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA2	100.0%	100.0%	100.0%	21.5%	68.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA3	100.0%	100.0%	100.0%	18.7%	73.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA4	100.0%	100.0%	100.0%	20.2%	71.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA5	100.0%	100.0%	100.0%	15.8%	72.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA6	100.0%	100.0%	100.0%	18.3%	73.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA1	100.0%	100.0%	100.0%	20.0%	70.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA2	100.0%	100.0%	100.0%	16.5%	73.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA3	100.0%	100.0%	100.0%	20.6%	66.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA4	100.0%	100.0%	100.0%	19.5%	72.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA5	100.0%	100.0%	100.0%	20.1%	69.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA6	100.0%	100.0%	100.0%	21.4%	68.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA1	100.0%	100.0%	100.0%	25.0%	62.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA2	100.0%	100.0%	100.0%	16.8%	68.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA3	100.0%	100.0%	100.0%	20.3%	67.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA4	100.0%	100.0%	100.0%	18.8%	72.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA5	100.0%	100.0%	100.0%	15.0%	75.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA6	100.0%	100.0%	100.0%	17.5%	68.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA1	100.0%	100.0%	100.0%	19.6%	71.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA2	100.0%	100.0%	100.0%	20.8%	67.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA3	100.0%	100.0%	100.0%	19.4%	70.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA4	100.0%	100.0%	100.0%	19.4%	73.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA5	100.0%	100.0%	100.0%	16.5%	74.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA6	100.0%	100.0%	100.0%	18.2%	71.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA1	100.0%	100.0%	100.0%	18.7%	71.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA2	100.0%	100.0%	100.0%	14.3%	71.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA3	100.0%	100.0%	100.0%	18.2%	74.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA4	100.0%	100.0%	100.0%	19.7%	70.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA5	100.0%	100.0%	100.0%	17.3%	69.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA6	100.0%	100.0%	100.0%	17.9%	69.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA1	100.0%	100.0%	100.0%	19.9%	69.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA2	100.0%	100.0%	100.0%	21.3%	68.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA3	100.0%	100.0%	100.0%	22.9%	70.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA4	100.0%	100.0%	100.0%	19.5%	72.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA5	100.0%	100.0%	100.0%	16.3%	72.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA6	100.0%	100.0%	100.0%	19.9%	70.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA1	100.0%	100.0%	100.0%	20.1%	72.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA2	100.0%	100.0%	100.0%	15.7%	76.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA3	100.0%	100.0%	100.0%	20.0%	68.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA4	100.0%	100.0%	100.0%	23.1%	66.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA5	100.0%	100.0%	100.0%	16.5%	75.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA6	100.0%	100.0%	100.0%	11.5%	61.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA1	100.0%	100.0%	100.0%	21.5%	67.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA2	100.0%	100.0%	100.0%	13.9%	75.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA3	100.0%	100.0%	100.0%	19.6%	72.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA4	100.0%	100.0%	100.0%	19.7%	72.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA5	100.0%	100.0%	100.0%	16.5%	73.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA6	100.0%	100.0%	100.0%	19.5%	69.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA1	100.0%	100.0%	100.0%	24.6%	62.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA2	100.0%	100.0%	100.0%	16.8%	68.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA3	100.0%	100.0%	100.0%	17.1%	72.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA4	100.0%	100.0%	100.0%	19.4%	69.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA5	100.0%	100.0%	100.0%	17.1%	72.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA6	100.0%	100.0%	100.0%	17.0%	73.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA1	100.0%	100.0%	100.0%	18.6%	71.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA2	100.0%	100.0%	100.0%	15.8%	74.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA3	100.0%	100.0%	100.0%	20.7%	69.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA4	100.0%	100.0%	100.0%	17.0%	76.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA5	100.0%	100.0%	100.0%	14.7%	75.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA6	100.0%	100.0%	100.0%	20.1%	70.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA1	100.0%	100.0%	100.0%	19.5%	70.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA2	100.0%	100.0%	100.0%	19.1%	68.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA3	100.0%	100.0%	100.0%	18.2%	71.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA4	100.0%	100.0%	100.0%	19.0%	72.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA5	100.0%	100.0%	100.0%	31.9%	55.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA6	100.0%	100.0%	100.0%	19.3%	70.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA1	100.0%	100.0%	100.0%	22.3%	64.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA2	100.0%	100.0%	100.0%	13.9%	73.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA3	100.0%	100.0%	100.0%	23.6%	66.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA4	100.0%	100.0%	100.0%	20.1%	71.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA5	100.0%	100.0%	100.0%	14.4%	76.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA6	100.0%	100.0%	100.0%	23.5%	66.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA1	100.0%	100.0%	100.0%	18.2%	72.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA2	100.0%	100.0%	100.0%	19.1%	72.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA3	100.0%	100.0%	100.0%	20.0%	69.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA4	100.0%	100.0%	100.0%	21.3%	67.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA5	100.0%	100.0%	100.0%	17.9%	72.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA6	100.0%	100.0%	100.0%	19.5%	74.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA1	100.0%	100.0%	100.0%	19.6%	71.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA2	100.0%	100.0%	100.0%	15.9%	73.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA3	100.0%	100.0%	100.0%	18.7%	72.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA4	100.0%	100.0%	100.0%	18.2%	73.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA5	100.0%	100.0%	100.0%	19.1%	70.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA6	100.0%	100.0%	100.0%	19.2%	71.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA1	100.0%	100.0%	100.0%	17.2%	73.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA2	100.0%	100.0%	100.0%	13.2%	75.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA3	100.0%	100.0%	100.0%	20.0%	69.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA4	100.0%	100.0%	100.0%	18.6%	71.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA5	100.0%	100.0%	100.0%	16.9%	73.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA6	100.0%	100.0%	100.0%	17.3%	68.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA1	100.0%	100.0%	100.0%	19.8%	69.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA2	100.0%	100.0%	100.0%	14.4%	72.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA3	100.0%	100.0%	100.0%	19.5%	72.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA4	100.0%	100.0%	100.0%	18.0%	73.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA5	100.0%	100.0%	100.0%	15.1%	75.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA6	100.0%	100.0%	100.0%	19.6%	71.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-pct-table_table

Sort	Column	Description	ID
\|\|	Total Reads	Total Reads	`flagstat_total_pct`
\|\|	Total Passed QC	Total Passed QC	`total_passed_pct`
\|\|	Mapped	Mapped	`mapped_passed_pct`
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed_pct`
\|\|	Duplicates	Duplicates	`duplicates_passed_pct`
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed_pct`
\|\|	Properly Paired	Properly Paired	`properly_paired_passed_pct`
\|\|	Self and mate mapped	Self and mate mapped	`with_itself_and_mate_mapped_passed_pct`
\|\|	Singletons	Singletons	`singletons_passed_pct`
\|\|	Mate mapped to diff chr	Mate mapped to diff chr	`with_mate_mapped_to_a_different_chr_passed_pct`
\|\|	Diff chr (mapQ >= 5)	Diff chr (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed_pct`

Mapped reads per contig

The samtools idxstats tool counts the number of mapped reads per chromosome / contig. Chromosomes with < 0.1% of the total aligned reads are omitted from this plot.

Created with MultiQC

Sample relationships

Plots interrogating sample relationships, based on final count matrices.

STAR_SALMON DESeq2 sample similarity

is generated from clustering by Euclidean distances between DESeq2 rlog values for each sample in the deseq2_qc.r script.

Created with MultiQC

STAR_SALMON DESeq2 PCA plot

PCA plot between samples in the experiment. These values are calculated using DESeq2 in the deseq2_qc.r script.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
CUSTOM_GETCHROMSIZES	getchromsizes	`1.21`
CUSTOM_TX2GENE	python	`3.10.4`
DESEQ2_QC_STAR_SALMON	bioconductor-deseq2	`1.46.0`
	r-base	`4.4.2`
DupRadar	bioconductor-dupradar	`1.32.0`
GTF2BED	perl	`5.26.2`
GTF_FILTER	python	`3.9.5`
MAKE_TRANSCRIPTS_FASTA	rsem	`1.3.1`
	star	`2.7.10a`
PICARD_MARKDUPLICATES	picard	`3.1.1`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
QUALIMAP_RNASEQ	qualimap	`2.3`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SALMON_QUANT	salmon	`1.10.3`
SAMTOOLS_FLAGSTAT	samtools	`1.21`
SAMTOOLS_IDXSTATS	samtools	`1.21`
SAMTOOLS_INDEX	samtools	`1.21`
SAMTOOLS_SORT_QUALIMAP	samtools	`1.21`
SAMTOOLS_STATS	samtools	`1.21`
SE_GENE_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SE_TRANSCRIPT_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
TXIMETA_TXIMPORT	bioconductor-tximeta	`1.20.1`
Workflow	Nextflow	`25.04.7`
	nf-core/rnaseq	`v3.22.2-g3816d48`

nf-core/rnaseq Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.https://github.com/nf-core/rnaseq

Methods

Data was processed using nf-core/rnaseq v3.22.2 (doi: 10.5281/zenodo.1400710) of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.04.7 (Di Tommaso et al., 2017) with the following command:

nextflow run nf-core/rnaseq -r 3.22.2 -c ../rnaseq.config -params-file ../params_rnaseq.json -resume -profile crg_slurm

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnaseq Workflow Summary

this information is collected when the pipeline is started.https://github.com/nf-core/rnaseq

Input/output options

input: ../samplesheet_Danio.csv
multiqc_title: PTox-WP6-Danio-without-deduplication
outdir: ./rnaseq_output

Reference genome options

fasta: ../../refs/Danio/genome_with_spikes.fa
gtf: ../../refs/Danio/genome_annotation_with_spikes.gtf
star_index: ../../rnaseq_run-Danio/rnaseq_output/genome/index/star

Read trimming options

extra_fastp_args: --length_required=20 --trim_poly_g --poly_g_min_len=20 --trim_poly_x --poly_x_min_len=15 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --dont_eval_duplication --cut_tail
trimmer: fastp

UMI options

umi_discard_read: 0

Alignment options

extra_salmon_quant_args: --noLengthCorrection
extra_star_align_args: --alignIntronMax 1000000 --alignIntronMin 20 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --outFilterMismatchNmax 999 --outFilterMultimapNmax 20 --outFilterType BySJout --outFilterMismatchNoverLmax 0.1 --clip3pAdapterSeq AAAAAAAA
stranded_threshold: 0.7

Process skipping options

skip_alignment: true
skip_bigwig: true
skip_biotype_qc: true
skip_preseq: false
skip_pseudo_alignment: true
skip_stringtie: true

Generic options

monochrome_logs: true
trace_report_suffix: 2026-06-19_21-20-09

Core Nextflow options

configFiles: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq/nextflow.config, /users/project/precisiontox_008279_no_backup/wp6_data/analyse_duplicated_data/rnaseq_run-Danio/../rnaseq.config
containerEngine: apptainer
launchDir: /users/project/precisiontox_008279_no_backup/wp6_data/analyse_duplicated_data/rnaseq_run-Danio
profile: crg_slurm
projectDir: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq
revision: 3.22.2
runName: exotic_sammet
userName: vntasis
workDir: /users/project/precisiontox_008279_no_backup/wp6_data/analyse_duplicated_data/rnaseq_run-Danio/work

PTox-WP6-Danio-without-deduplication

MultiQC Toolbox

Apply Highlight Samples

Rename Samples Bulk input Apply

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots All None

Save Settings

Load Settings

Tool Citations

About MultiQC

PTox-WP6-Danio-without-deduplication

Report AI Summary

General Statistics

AI Summary

General Statistics: Columns

Sample status checks

Strandedness Checks

AI Summary

Samples strandedness check: Columns

DupRadar

AI Summary

Picard

Mark Duplicates Help

AI Summary

Preseq

Complexity curve (molecule count)

AI Summary

QualiMap

Genomic origin of reads Help

AI Summary

Gene Coverage Profile Help

AI Summary

RSeQC

Read Distribution

AI Summary

Read Duplication

AI Summary

Junction Annotation

AI Summary

Junction Saturation

AI Summary

Infer experiment

AI Summary

Bam Stat

AI Summary

RSeQC: Bam Stat: Columns

Samtools

Percent mapped Help

AI Summary

Alignment stats

AI Summary

Samtools: stats: Alignment Stats: Columns

Flagstat

AI Summary

Samtools: flagstat: read count: Columns

Flagstat: Percentage of total

AI Summary

Samtools: flagstat: percentage of total: Columns

Mapped reads per contig

AI Summary

Sample relationships

STAR_SALMON DESeq2 sample similarity

AI Summary

STAR_SALMON DESeq2 PCA plot

AI Summary

Software Versions

AI Summary

nf-core/rnaseq Methods Description

AI Summary

Methods

References

Notes:

nf-core/rnaseq Workflow Summary

AI Summary

Highlight Samples

Rename Samples

Show / Hide Samples

Choose Plots

Mark Duplicates

Genomic origin of reads

Gene Coverage Profile

Percent mapped