PTox-WP6-Danio

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnaseq analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-09, 13:01 UTC based on data in: /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-Danio/work/4a/6264f847d879af90b086f31846b860

Because this report contains a lot of samples, you may need to click 'Show plot' to see some graphs.

General Statistics

Showing ¹⁹²/₁₉₂ rows and ²²/₄₅ columns.

Sample Name	5'-3' bias	M Aligned	Exonic	Intronic	Intergenic	Overlapping Exon	Error rate	Non-primary	Reads mapped	% Mapped	% Proper pairs	% MapQ 0 reads	Total seqs	Mean insert	Reads	Reads mapped	% Reads mapped	rRNA	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	M Unique Reads	% Pass Dedup	Dups	GC	Avg len	Median len	Failed	Seqs	% > Q30	Mb Q30 bases	Reads After Filtering	GC content	% PF	% Adapter	Mean R1 Length	Dups	GC	Avg len	Median len	Failed	Seqs
RZY000ZA1	0.57	2.0M	1.1M	0.5M	0.2M	0.1M	0.91%	0.9M	2.0M	100.0%	0.0%	3.8%	2.0M	0.0bp	2.9M	2.9M	100.0%	7.0%	18.9M	17.6M	93.0%	16.4M	86.4%	1.2M	2.9M	12.4%	73.8%	42.0%	151bp	151bp	27%	27.3M	87.7%	1929.4Mb	20.4M	36.5%	74.7%	48.5%	141.0bp	84.3%	36.0%	108bp	137bp	36%	20.4M
RZY000ZA2	0.68	1.7M	0.9M	0.5M	0.1M	0.1M	0.92%	0.8M	1.7M	100.0%	0.0%	4.1%	1.7M	0.0bp	2.5M	2.5M	100.0%	8.5%	8.9M	7.9M	89.5%	7.2M	81.6%	0.7M	2.5M	22.1%	58.4%	47.0%	151bp	151bp	36%	15.1M	86.3%	874.2Mb	9.7M	37.3%	64.3%	55.0%	141.0bp	72.7%	37.0%	104bp	127bp	36%	9.7M
RZY000ZA3	0.75	1.7M	0.9M	0.4M	0.1M	0.1M	0.92%	0.8M	1.7M	100.0%	0.0%	4.1%	1.7M	0.0bp	2.5M	2.5M	100.0%	6.7%	9.6M	8.9M	92.2%	8.0M	83.3%	0.9M	2.5M	20.0%	61.6%	45.0%	151bp	151bp	27%	15.2M	88.1%	934.7Mb	10.3M	37.7%	67.8%	56.3%	141.0bp	76.2%	37.0%	103bp	122bp	36%	10.3M
RZY000ZA4	0.75	2.2M	1.2M	0.6M	0.2M	0.2M	0.91%	1.0M	2.2M	100.0%	0.0%	4.0%	2.2M	0.0bp	3.2M	3.2M	100.0%	4.8%	11.8M	10.8M	91.0%	9.8M	82.5%	1.0M	3.2M	22.2%	59.3%	46.0%	151bp	151bp	27%	18.9M	87.4%	1129.1Mb	12.4M	37.6%	65.8%	56.2%	141.0bp	74.1%	37.0%	104bp	127bp	36%	12.4M
RZY000ZA5	0.83	2.2M	1.2M	0.6M	0.2M	0.2M	0.90%	0.8M	2.2M	100.0%	0.0%	3.3%	2.2M	0.0bp	3.1M	3.1M	100.0%	7.6%	9.7M	8.9M	91.7%	8.1M	83.9%	0.8M	3.1M	26.4%	55.4%	44.0%	151bp	151bp	36%	15.2M	87.4%	988.7Mb	10.5M	36.9%	69.1%	50.6%	141.0bp	70.6%	36.0%	108bp	137bp	36%	10.5M
RZY000ZA6	0.75	1.9M	1.0M	0.5M	0.1M	0.1M	0.88%	0.9M	1.9M	100.0%	0.0%	4.1%	1.9M	0.0bp	2.7M	2.7M	100.0%	6.4%	9.8M	8.8M	89.4%	8.0M	81.3%	0.8M	2.7M	23.1%	57.6%	47.0%	151bp	151bp	27%	17.2M	87.4%	962.6Mb	10.5M	37.6%	60.9%	56.9%	141.0bp	73.1%	37.0%	105bp	127bp	36%	10.5M
RZY019HA1	0.56	2.2M	1.2M	0.6M	0.2M	0.1M	0.92%	0.9M	2.2M	100.0%	0.0%	3.8%	2.2M	0.0bp	3.1M	3.1M	100.0%	8.3%	9.1M	8.2M	90.7%	7.4M	81.6%	0.8M	3.1M	26.9%	53.1%	45.0%	151bp	151bp	36%	14.5M	87.1%	899.4Mb	9.9M	36.8%	68.2%	53.8%	141.0bp	68.5%	36.0%	104bp	127bp	36%	9.9M
RZY019HA2	0.67	2.0M	1.1M	0.5M	0.2M	0.1M	0.92%	0.8M	2.0M	100.0%	0.0%	3.5%	2.0M	0.0bp	2.8M	2.8M	100.0%	9.0%	8.4M	7.6M	91.0%	6.9M	82.2%	0.7M	2.8M	26.8%	54.0%	43.0%	151bp	151bp	27%	13.5M	86.6%	841.7Mb	9.2M	35.8%	68.0%	52.6%	141.0bp	68.4%	35.0%	106bp	127bp	36%	9.2M
RZY019HA3	0.75	2.1M	1.1M	0.6M	0.2M	0.1M	0.91%	0.9M	2.1M	100.0%	0.0%	3.7%	2.1M	0.0bp	2.9M	2.9M	100.0%	5.4%	11.5M	10.6M	92.3%	9.6M	83.5%	1.0M	2.9M	20.3%	61.0%	44.0%	151bp	151bp	27%	18.3M	87.7%	1104.1Mb	12.1M	36.9%	66.4%	56.1%	141.0bp	75.6%	36.0%	104bp	127bp	36%	12.1M
RZY019HA4	0.57	2.7M	1.5M	0.8M	0.2M	0.2M	0.91%	1.0M	2.7M	100.0%	0.0%	3.3%	2.7M	0.0bp	3.7M	3.7M	100.0%	7.6%	12.7M	11.7M	92.2%	10.7M	84.7%	1.0M	3.7M	24.4%	58.3%	44.0%	151bp	151bp	27%	19.1M	87.9%	1308.0Mb	13.7M	37.0%	71.9%	48.7%	141.0bp	73.0%	37.0%	109bp	137bp	36%	13.7M
RZY019HA5	0.84	2.2M	1.2M	0.6M	0.2M	0.2M	0.89%	0.8M	2.2M	100.0%	0.0%	3.5%	2.2M	0.0bp	3.0M	3.0M	100.0%	8.4%	10.5M	9.6M	91.6%	8.8M	83.5%	0.8M	3.0M	24.1%	58.0%	45.0%	151bp	151bp	27%	17.6M	87.9%	1072.4Mb	11.4M	37.2%	64.9%	54.2%	141.0bp	73.7%	37.0%	107bp	132bp	36%	11.4M
RZY019HA6	0.70	2.1M	1.1M	0.6M	0.2M	0.2M	0.91%	0.9M	2.1M	100.0%	0.0%	3.7%	2.1M	0.0bp	3.0M	3.0M	100.0%	6.3%	11.1M	10.1M	91.4%	9.3M	83.8%	0.8M	3.0M	22.6%	58.7%	46.0%	151bp	151bp	27%	18.3M	87.4%	1086.7Mb	11.8M	37.2%	64.9%	56.1%	141.0bp	74.1%	37.0%	105bp	127bp	36%	11.8M
RZY019LA1	0.60	1.5M	0.8M	0.4M	0.1M	0.1M	0.88%	0.7M	1.5M	100.0%	0.0%	4.1%	1.5M	0.0bp	2.2M	2.2M	100.0%	7.9%	9.0M	8.2M	91.6%	7.3M	81.6%	0.9M	2.2M	19.1%	61.3%	45.0%	151bp	151bp	27%	15.1M	87.1%	868.0Mb	9.7M	36.8%	64.6%	57.5%	141.0bp	76.4%	36.0%	102bp	122bp	36%	9.7M
RZY019LA2	0.75	2.5M	1.3M	0.7M	0.2M	0.2M	0.94%	1.1M	2.5M	100.0%	0.0%	4.1%	2.5M	0.0bp	3.6M	3.6M	100.0%	6.5%	15.2M	13.8M	90.6%	12.4M	81.9%	1.3M	3.6M	18.9%	63.1%	45.0%	151bp	151bp	27%	24.9M	87.1%	1462.5Mb	16.3M	36.3%	65.3%	56.4%	141.0bp	76.6%	36.0%	103bp	122bp	36%	16.3M
RZY019LA3	0.81	2.3M	1.2M	0.6M	0.2M	0.2M	0.93%	1.0M	2.3M	100.0%	0.0%	3.9%	2.3M	0.0bp	3.4M	3.4M	100.0%	6.7%	13.0M	11.8M	90.7%	10.8M	83.2%	1.0M	3.4M	21.0%	61.2%	45.0%	151bp	151bp	27%	21.1M	87.4%	1271.1Mb	13.9M	36.9%	66.1%	54.9%	141.0bp	75.0%	36.0%	104bp	127bp	36%	13.9M
RZY019LA4	0.59	2.1M	1.1M	0.6M	0.2M	0.1M	0.93%	1.0M	2.1M	100.0%	0.0%	4.1%	2.1M	0.0bp	3.1M	3.1M	100.0%	6.4%	12.2M	11.2M	91.3%	10.2M	83.8%	0.9M	3.1M	20.3%	61.9%	47.0%	151bp	151bp	36%	20.3M	87.2%	1173.2Mb	13.1M	37.3%	64.3%	57.2%	141.0bp	76.3%	37.0%	103bp	122bp	36%	13.1M
RZY019LA5	0.81	2.2M	1.2M	0.6M	0.2M	0.2M	0.89%	0.9M	2.2M	100.0%	0.0%	3.5%	2.2M	0.0bp	3.1M	3.1M	100.0%	7.0%	12.5M	11.5M	91.9%	10.5M	84.3%	0.9M	3.1M	20.6%	62.0%	45.0%	151bp	151bp	27%	19.7M	87.5%	1260.0Mb	13.4M	37.2%	68.1%	51.9%	141.0bp	76.3%	37.0%	107bp	137bp	36%	13.4M
RZY019LA6	0.80	2.2M	1.2M	0.6M	0.2M	0.2M	0.88%	0.8M	2.2M	100.0%	0.0%	3.4%	2.2M	0.0bp	3.0M	3.0M	100.0%	6.4%	10.7M	9.8M	91.1%	9.0M	83.8%	0.8M	3.0M	23.9%	57.1%	47.0%	151bp	151bp	36%	17.7M	87.7%	1078.1Mb	11.5M	38.0%	64.8%	53.5%	141.0bp	73.2%	38.0%	107bp	137bp	36%	11.5M
RZY996LA1	0.65	2.3M	1.3M	0.6M	0.2M	0.2M	0.91%	1.1M	2.3M	100.0%	0.0%	4.2%	2.3M	0.0bp	3.4M	3.4M	100.0%	7.0%	22.6M	20.8M	92.2%	18.8M	83.2%	2.0M	3.4M	12.0%	73.0%	43.0%	151bp	151bp	27%	35.0M	87.4%	2228.8Mb	24.3M	36.4%	69.5%	53.3%	141.0bp	84.2%	36.0%	105bp	127bp	36%	24.3M
RZY996LA2	0.60	1.5M	0.8M	0.4M	0.1M	0.1M	0.88%	0.7M	1.5M	100.0%	0.0%	3.9%	1.5M	0.0bp	2.2M	2.2M	100.0%	8.7%	10.0M	9.1M	90.7%	8.2M	81.9%	0.9M	2.2M	17.3%	65.7%	46.0%	151bp	151bp	36%	16.6M	87.2%	1013.8Mb	11.0M	37.2%	65.8%	53.3%	141.0bp	78.1%	37.0%	106bp	132bp	36%	11.0M
RZY996LA3	0.56	2.0M	1.1M	0.5M	0.2M	0.1M	0.92%	0.9M	2.0M	100.0%	0.0%	3.8%	2.0M	0.0bp	2.9M	2.9M	100.0%	6.6%	9.2M	8.5M	92.1%	7.8M	84.8%	0.7M	2.9M	25.3%	55.6%	45.0%	151bp	151bp	27%	14.7M	87.5%	895.2Mb	9.9M	36.7%	67.1%	55.7%	141.0bp	71.7%	36.0%	104bp	127bp	36%	9.9M
RZY996LA4	0.65	1.9M	1.0M	0.5M	0.1M	0.1M	0.90%	0.9M	1.9M	100.0%	0.0%	4.5%	1.9M	0.0bp	2.8M	2.8M	100.0%	5.4%	10.1M	9.0M	89.5%	8.1M	80.2%	0.9M	2.8M	22.1%	58.8%	48.0%	151bp	151bp	27%	18.2M	87.6%	941.2Mb	10.7M	37.8%	58.6%	61.4%	141.0bp	73.6%	37.0%	101bp	117bp	36%	10.7M
RZY996LA5	0.76	2.1M	1.2M	0.6M	0.2M	0.2M	0.89%	0.8M	2.1M	100.0%	0.0%	3.4%	2.1M	0.0bp	3.0M	3.0M	100.0%	7.5%	11.6M	10.7M	92.6%	9.8M	85.0%	0.9M	3.0M	21.3%	60.7%	45.0%	151bp	151bp	36%	17.6M	87.5%	1174.5Mb	12.5M	37.3%	71.1%	51.2%	141.0bp	75.3%	37.0%	107bp	132bp	36%	12.5M
RZY996LA6	0.75	2.1M	1.1M	0.6M	0.2M	0.1M	0.90%	0.9M	2.1M	100.0%	0.0%	4.0%	2.1M	0.0bp	3.0M	3.0M	100.0%	7.1%	11.3M	10.3M	90.9%	9.4M	82.8%	0.9M	3.0M	21.9%	59.0%	47.0%	151bp	151bp	27%	20.2M	87.3%	1093.6Mb	12.2M	37.6%	60.6%	59.3%	141.0bp	75.0%	37.0%	103bp	122bp	36%	12.2M
RZY996MA1	0.61	1.5M	0.8M	0.4M	0.1M	0.1M	0.91%	0.8M	1.5M	100.0%	0.0%	5.1%	1.5M	0.0bp	2.3M	2.3M	100.0%	6.0%	14.1M	12.6M	89.1%	11.2M	79.3%	1.4M	2.3M	12.5%	70.8%	47.0%	151bp	151bp	27%	26.1M	86.0%	1183.0Mb	15.0M	37.1%	57.6%	67.6%	141.0bp	82.6%	37.0%	91bp	87bp	36%	15.0M
RZY996MA2	0.72	2.1M	1.2M	0.6M	0.2M	0.1M	0.93%	0.9M	2.1M	100.0%	0.0%	3.6%	2.1M	0.0bp	3.0M	3.0M	100.0%	7.1%	10.4M	9.6M	92.7%	8.9M	85.7%	0.7M	3.0M	23.6%	58.8%	44.0%	151bp	151bp	27%	16.2M	87.5%	1015.7Mb	11.2M	36.6%	69.0%	54.3%	141.0bp	73.2%	36.0%	104bp	127bp	36%	11.2M
RZY996MA3	0.71	2.0M	1.1M	0.5M	0.2M	0.1M	0.93%	0.8M	2.0M	100.0%	0.0%	3.6%	2.0M	0.0bp	2.8M	2.8M	100.0%	7.0%	10.0M	9.3M	92.5%	8.6M	85.9%	0.7M	2.8M	22.3%	58.8%	43.0%	151bp	151bp	27%	15.1M	87.6%	1005.3Mb	10.8M	36.9%	71.6%	51.4%	141.0bp	74.1%	36.0%	106bp	132bp	36%	10.8M
RZY996MA4	0.72	2.1M	1.2M	0.6M	0.2M	0.2M	0.89%	0.9M	2.1M	100.0%	0.0%	3.8%	2.1M	0.0bp	3.0M	3.0M	100.0%	6.0%	10.6M	9.6M	90.9%	8.8M	83.5%	0.8M	3.0M	23.4%	57.9%	45.0%	151bp	151bp	27%	17.2M	87.9%	1039.8Mb	11.2M	37.1%	65.1%	55.3%	141.0bp	73.1%	37.0%	105bp	132bp	36%	11.2M
RZY996MA5	0.68	1.9M	1.0M	0.5M	0.2M	0.1M	0.91%	0.8M	1.9M	100.0%	0.0%	4.0%	1.9M	0.0bp	2.7M	2.7M	100.0%	7.1%	9.8M	8.9M	91.2%	8.1M	83.1%	0.8M	2.7M	22.9%	58.0%	46.0%	151bp	151bp	27%	16.5M	87.2%	950.7Mb	10.5M	36.8%	64.0%	57.4%	141.0bp	73.9%	36.0%	103bp	122bp	36%	10.5M
RZY996MA6	0.90	1.8M	1.0M	0.5M	0.1M	0.1M	0.90%	0.8M	1.8M	100.0%	0.0%	3.7%	1.8M	0.0bp	2.6M	2.6M	100.0%	5.4%	10.1M	9.2M	91.6%	8.4M	83.3%	0.8M	2.6M	21.5%	59.5%	46.0%	151bp	151bp	27%	17.0M	87.9%	972.3Mb	10.7M	37.7%	62.7%	58.4%	141.0bp	75.4%	37.0%	104bp	122bp	36%	10.7M
RZY999ZA1	0.73	2.5M	1.3M	0.6M	0.2M	0.2M	0.92%	1.3M	2.5M	100.0%	0.0%	4.5%	2.5M	0.0bp	3.7M	3.7M	100.0%	8.6%	24.2M	22.0M	90.9%	19.6M	81.2%	2.4M	3.7M	11.9%	71.6%	46.0%	151bp	151bp	36%	41.3M	87.5%	2378.0Mb	26.4M	37.3%	64.1%	56.9%	141.0bp	84.3%	37.0%	103bp	122bp	36%	26.4M
RZY999ZA2	0.51	1.5M	0.8M	0.4M	0.1M	0.1M	0.90%	0.6M	1.5M	100.0%	0.0%	3.5%	1.5M	0.0bp	2.0M	2.0M	100.0%	8.2%	6.9M	6.3M	91.9%	5.8M	84.8%	0.5M	2.0M	24.0%	57.5%	45.0%	151bp	151bp	27%	11.4M	87.5%	683.9Mb	7.5M	37.0%	65.7%	55.3%	141.0bp	72.1%	36.0%	105bp	127bp	36%	7.5M
RZY999ZA3	0.68	2.1M	1.1M	0.6M	0.2M	0.1M	0.91%	0.9M	2.1M	100.0%	0.0%	3.6%	2.1M	0.0bp	3.0M	3.0M	100.0%	8.0%	10.9M	10.0M	91.9%	9.1M	83.4%	0.9M	3.0M	21.4%	59.8%	44.0%	151bp	151bp	27%	17.2M	87.1%	1079.4Mb	11.8M	36.5%	68.7%	52.3%	141.0bp	74.2%	36.0%	105bp	127bp	36%	11.8M
RZY999ZA4	0.76	1.9M	1.0M	0.5M	0.2M	0.1M	0.93%	1.0M	1.9M	100.0%	0.0%	4.4%	1.9M	0.0bp	2.9M	2.9M	100.0%	5.9%	11.1M	10.0M	90.1%	9.0M	81.0%	1.0M	2.9M	20.4%	60.7%	46.0%	151bp	151bp	27%	17.9M	87.1%	1067.1Mb	11.8M	37.4%	65.7%	55.3%	141.0bp	74.8%	37.0%	104bp	127bp	36%	11.8M
RZY999ZA5	0.74	2.0M	1.1M	0.5M	0.2M	0.1M	0.92%	0.8M	2.0M	100.0%	0.0%	3.6%	2.0M	0.0bp	2.8M	2.8M	100.0%	6.9%	9.6M	8.8M	91.8%	8.0M	83.0%	0.8M	2.8M	24.1%	57.3%	45.0%	151bp	151bp	27%	15.8M	87.4%	943.0Mb	10.3M	36.8%	65.1%	55.6%	141.0bp	72.9%	36.0%	105bp	127bp	36%	10.3M
RZY999ZA6	0.69	1.9M	1.0M	0.5M	0.2M	0.1M	0.90%	0.8M	1.9M	100.0%	0.0%	3.7%	1.9M	0.0bp	2.7M	2.7M	100.0%	6.2%	10.3M	9.5M	92.1%	8.6M	84.2%	0.8M	2.7M	21.4%	61.0%	45.0%	151bp	151bp	27%	16.7M	87.6%	1003.0Mb	10.9M	37.0%	65.7%	56.3%	141.0bp	75.6%	36.0%	105bp	127bp	36%	10.9M
RZZ000ZA1	0.70	2.2M	1.3M	0.5M	0.2M	0.2M	0.92%	0.7M	2.2M	100.0%	0.0%	2.8%	2.2M	0.0bp	2.9M	2.9M	100.0%	10.5%	11.7M	11.2M	95.5%	10.4M	88.5%	0.8M	2.9M	20.5%	63.6%	36.0%	151bp	151bp	27%	14.6M	87.2%	1317.6Mb	13.1M	35.5%	89.5%	34.1%	141.0bp	77.5%	35.0%	115bp	141bp	36%	13.1M
RZZ000ZA2	1.30	0.9M	0.5M	0.3M	0.1M	0.1M	0.97%	0.3M	0.9M	100.0%	0.0%	2.4%	0.9M	0.0bp	1.2M	1.2M	100.0%	5.1%	8.2M	7.9M	95.9%	7.5M	91.5%	0.4M	1.2M	13.2%	74.6%	39.0%	151bp	151bp	27%	10.2M	89.2%	865.2Mb	8.7M	36.9%	85.2%	43.7%	141.0bp	84.4%	36.0%	112bp	137bp	36%	8.7M
RZZ000ZA3	0.76	2.6M	1.5M	0.7M	0.2M	0.2M	0.94%	0.8M	2.6M	100.0%	0.0%	2.7%	2.6M	0.0bp	3.4M	3.4M	100.0%	8.2%	14.1M	13.5M	96.1%	12.6M	89.8%	0.9M	3.4M	20.8%	63.0%	37.0%	151bp	151bp	27%	16.9M	87.6%	1535.9Mb	15.3M	36.2%	90.7%	35.9%	141.0bp	77.5%	36.0%	114bp	141bp	36%	15.3M
RZZ000ZA4	0.70	3.2M	1.6M	1.0M	0.3M	0.2M	1.00%	0.9M	3.2M	100.0%	0.0%	2.6%	3.2M	0.0bp	4.1M	4.1M	100.0%	7.2%	17.8M	17.2M	96.4%	16.1M	90.2%	1.1M	4.1M	19.8%	69.9%	35.0%	151bp	151bp	27%	20.1M	88.9%	1951.2Mb	19.2M	35.8%	95.7%	35.4%	141.0bp	78.7%	35.0%	114bp	141bp	27%	19.2M
RZZ000ZA5	0.91	4.0M	2.3M	1.1M	0.3M	0.3M	0.93%	1.1M	4.0M	100.0%	0.0%	2.3%	4.0M	0.0bp	5.1M	5.1M	100.0%	7.5%	21.1M	20.2M	96.0%	19.0M	90.5%	1.2M	5.1M	21.3%	62.7%	37.0%	151bp	151bp	27%	25.1M	88.1%	2344.8Mb	22.8M	36.7%	90.5%	33.7%	141.0bp	77.8%	36.0%	117bp	141bp	36%	22.8M
RZZ000ZA6	0.94	2.3M	1.2M	0.7M	0.2M	0.2M	0.96%	0.9M	2.3M	100.0%	0.0%	3.5%	2.3M	0.0bp	3.3M	3.3M	100.0%	5.6%	14.9M	14.0M	93.6%	12.9M	86.3%	1.1M	3.3M	18.4%	65.5%	43.0%	151bp	151bp	27%	21.6M	87.8%	1444.2Mb	15.8M	36.5%	73.0%	53.9%	141.0bp	79.1%	36.0%	104bp	127bp	36%	15.8M
RZZ014HA1	0.67	2.0M	1.2M	0.5M	0.2M	0.2M	0.94%	0.7M	2.0M	100.0%	0.0%	2.8%	2.0M	0.0bp	2.7M	2.7M	100.0%	9.1%	12.7M	12.2M	96.0%	11.4M	89.3%	0.9M	2.7M	18.4%	65.3%	37.0%	151bp	151bp	36%	15.7M	87.3%	1406.0Mb	14.0M	36.3%	89.3%	35.2%	141.0bp	79.8%	36.0%	115bp	141bp	36%	14.0M
RZZ014HA2	0.88	2.3M	1.3M	0.6M	0.2M	0.2M	0.94%	0.7M	2.3M	100.0%	0.0%	2.6%	2.3M	0.0bp	3.1M	3.1M	100.0%	6.0%	15.0M	14.5M	96.6%	13.9M	92.3%	0.6M	3.1M	18.2%	68.2%	38.0%	151bp	151bp	36%	17.5M	88.7%	1575.3Mb	16.0M	36.9%	91.5%	41.1%	141.0bp	80.8%	36.0%	111bp	137bp	36%	16.0M
RZZ014HA3	0.86	2.9M	1.6M	0.8M	0.2M	0.2M	0.95%	1.0M	2.9M	100.0%	0.0%	3.1%	2.9M	0.0bp	3.9M	3.9M	100.0%	7.4%	12.7M	12.1M	95.1%	11.1M	87.2%	1.0M	3.9M	25.1%	54.0%	41.0%	151bp	151bp	27%	16.8M	86.8%	1280.5Mb	13.7M	36.6%	81.5%	47.1%	141.0bp	72.2%	36.0%	108bp	132bp	36%	13.7M
RZZ014HA4	0.70	2.7M	1.6M	0.7M	0.2M	0.2M	0.92%	0.9M	2.7M	100.0%	0.0%	2.9%	2.7M	0.0bp	3.6M	3.6M	100.0%	8.7%	16.8M	16.1M	95.8%	14.7M	87.5%	1.4M	3.6M	18.1%	66.9%	38.0%	151bp	151bp	27%	21.1M	88.0%	1788.8Mb	18.4M	36.6%	86.9%	40.0%	141.0bp	79.9%	36.0%	111bp	137bp	36%	18.4M
RZZ014HA5	0.76	2.3M	1.4M	0.6M	0.2M	0.2M	0.94%	0.7M	2.3M	100.0%	0.0%	2.6%	2.3M	0.0bp	3.1M	3.1M	100.0%	8.0%	14.6M	14.0M	96.1%	13.2M	90.7%	0.8M	3.1M	18.6%	64.5%	38.0%	151bp	151bp	27%	17.7M	87.5%	1590.6Mb	15.8M	36.9%	89.2%	36.5%	141.0bp	79.6%	36.0%	115bp	141bp	36%	15.8M
RZZ014HA6	0.65	3.0M	1.7M	0.8M	0.2M	0.2M	0.91%	1.0M	3.0M	100.0%	0.0%	2.8%	3.0M	0.0bp	4.0M	4.0M	100.0%	8.2%	16.1M	15.5M	96.3%	14.1M	87.8%	1.4M	4.0M	20.6%	63.6%	38.0%	151bp	151bp	36%	19.7M	88.4%	1702.2Mb	17.5M	36.3%	88.7%	40.9%	141.0bp	77.8%	36.0%	110bp	137bp	36%	17.5M
RZZ014LA1	0.87	2.8M	1.6M	0.8M	0.2M	0.2M	0.95%	1.0M	2.8M	100.0%	0.0%	3.0%	2.8M	0.0bp	3.8M	3.8M	100.0%	9.1%	15.0M	14.2M	95.1%	13.2M	87.9%	1.1M	3.8M	21.2%	61.0%	38.0%	151bp	151bp	36%	19.3M	87.3%	1623.9Mb	16.5M	36.0%	85.4%	39.0%	141.0bp	76.4%	36.0%	113bp	141bp	36%	16.5M
RZZ014LA2	0.73	2.6M	1.4M	0.7M	0.2M	0.2M	0.92%	0.8M	2.6M	100.0%	0.0%	2.6%	2.6M	0.0bp	3.4M	3.4M	100.0%	7.8%	15.8M	15.2M	96.1%	14.3M	90.3%	0.9M	3.4M	18.7%	66.8%	38.0%	151bp	151bp	36%	19.4M	88.5%	1702.7Mb	17.2M	37.1%	88.5%	40.0%	141.0bp	79.9%	37.0%	112bp	141bp	36%	17.2M
RZZ014LA3	0.83	2.5M	1.4M	0.6M	0.2M	0.2M	0.94%	0.9M	2.5M	100.0%	0.0%	3.0%	2.5M	0.0bp	3.3M	3.3M	100.0%	8.3%	15.2M	14.5M	95.8%	13.5M	89.2%	1.0M	3.3M	18.7%	64.4%	38.0%	151bp	151bp	27%	18.8M	87.4%	1636.7Mb	16.6M	36.2%	88.1%	38.3%	141.0bp	79.1%	36.0%	113bp	141bp	36%	16.6M
RZZ014LA4	0.70	2.3M	1.3M	0.6M	0.2M	0.2M	0.91%	0.8M	2.3M	100.0%	0.0%	3.0%	2.3M	0.0bp	3.1M	3.1M	100.0%	9.5%	13.7M	13.1M	95.7%	12.1M	88.5%	1.0M	3.1M	19.3%	66.9%	36.0%	151bp	151bp	27%	16.9M	87.9%	1476.6Mb	15.2M	35.5%	89.5%	39.3%	141.0bp	78.8%	35.0%	111bp	137bp	36%	15.2M
RZZ014LA5	0.73	3.5M	2.1M	0.9M	0.3M	0.3M	0.92%	0.8M	3.5M	100.0%	0.0%	2.0%	3.5M	0.0bp	4.3M	4.3M	100.0%	8.8%	15.8M	15.2M	96.0%	14.4M	90.8%	0.8M	4.3M	24.6%	58.1%	38.0%	151bp	151bp	27%	19.5M	87.8%	1806.0Mb	17.4M	37.1%	88.9%	32.3%	141.0bp	74.6%	37.0%	118bp	141bp	27%	17.4M
RZZ014LA6	0.67	2.4M	1.4M	0.6M	0.2M	0.2M	0.88%	0.6M	2.4M	100.0%	0.0%	2.0%	2.4M	0.0bp	3.0M	3.0M	100.0%	6.9%	11.7M	11.3M	96.4%	10.6M	90.5%	0.7M	3.0M	22.8%	62.8%	39.0%	151bp	151bp	27%	13.7M	89.6%	1354.5Mb	12.5M	38.0%	91.6%	29.5%	141.0bp	76.3%	38.0%	121bp	141bp	27%	12.5M
RZZ015HA1	0.80	2.8M	1.6M	0.7M	0.2M	0.2M	0.96%	0.9M	2.8M	100.0%	0.0%	2.7%	2.8M	0.0bp	3.7M	3.7M	100.0%	9.1%	14.9M	14.2M	95.6%	13.3M	89.1%	1.0M	3.7M	21.1%	60.5%	38.0%	151bp	151bp	36%	18.8M	87.0%	1611.9Mb	16.4M	36.1%	86.9%	38.2%	141.0bp	76.9%	36.0%	113bp	141bp	36%	16.4M
RZZ015HA2	0.88	2.4M	1.4M	0.7M	0.2M	0.2M	0.94%	0.8M	2.4M	100.0%	0.0%	2.7%	2.4M	0.0bp	3.2M	3.2M	100.0%	6.9%	11.4M	10.8M	94.9%	10.1M	88.8%	0.7M	3.2M	24.9%	55.7%	39.0%	151bp	151bp	27%	15.4M	88.4%	1192.1Mb	12.2M	36.0%	79.6%	45.6%	141.0bp	73.7%	35.0%	110bp	141bp	36%	12.2M
RZZ015HA3	0.83	3.3M	1.9M	0.8M	0.3M	0.2M	0.97%	1.0M	3.3M	100.0%	0.0%	2.5%	3.3M	0.0bp	4.2M	4.2M	100.0%	9.2%	16.0M	15.3M	96.0%	14.3M	89.4%	1.1M	4.2M	22.8%	61.1%	36.0%	151bp	151bp	27%	19.1M	87.2%	1755.2Mb	17.6M	35.3%	92.3%	34.7%	141.0bp	75.7%	35.0%	114bp	141bp	36%	17.6M
RZZ015HA4	0.79	2.3M	1.3M	0.6M	0.2M	0.2M	0.93%	0.8M	2.3M	100.0%	0.0%	3.0%	2.3M	0.0bp	3.1M	3.1M	100.0%	8.5%	13.8M	13.2M	95.9%	12.2M	88.7%	1.0M	3.1M	18.7%	66.3%	37.0%	151bp	151bp	36%	16.9M	87.4%	1467.0Mb	15.1M	36.0%	89.2%	38.7%	141.0bp	79.2%	35.0%	111bp	137bp	36%	15.1M
RZZ015HA5	0.69	3.0M	1.7M	0.8M	0.2M	0.2M	0.94%	1.0M	3.0M	100.0%	0.0%	2.7%	3.0M	0.0bp	4.0M	4.0M	100.0%	7.8%	18.6M	17.9M	96.1%	16.6M	89.1%	1.3M	4.0M	18.4%	65.3%	37.0%	151bp	151bp	27%	22.4M	87.8%	2034.2Mb	20.2M	36.3%	90.3%	36.0%	141.0bp	80.0%	36.0%	115bp	141bp	36%	20.2M
RZZ015HA6	1.00	2.2M	1.2M	0.6M	0.2M	0.1M	0.95%	1.0M	2.2M	100.0%	0.0%	4.0%	2.2M	0.0bp	3.1M	3.1M	100.0%	5.1%	15.5M	14.4M	92.9%	13.4M	86.6%	1.0M	3.1M	16.9%	64.6%	45.0%	151bp	151bp	27%	24.1M	87.3%	1411.0Mb	16.3M	36.6%	67.6%	60.1%	141.0bp	80.3%	36.0%	99bp	107bp	36%	16.3M
RZZ015LA1	0.69	3.1M	1.7M	0.9M	0.3M	0.2M	0.98%	1.0M	3.1M	100.0%	0.0%	2.7%	3.1M	0.0bp	4.1M	4.1M	100.0%	7.9%	14.4M	13.7M	95.2%	12.8M	88.5%	1.0M	4.1M	24.3%	57.6%	38.0%	151bp	151bp	27%	18.3M	87.2%	1543.0Mb	15.7M	36.0%	85.3%	39.2%	141.0bp	73.6%	35.0%	113bp	141bp	36%	15.7M
RZZ015LA2	0.79	3.4M	1.9M	0.9M	0.3M	0.3M	0.92%	0.8M	3.4M	100.0%	0.0%	2.1%	3.4M	0.0bp	4.2M	4.2M	100.0%	7.6%	15.2M	14.6M	96.4%	13.8M	91.3%	0.8M	4.2M	24.8%	59.8%	38.0%	151bp	151bp	36%	18.1M	88.7%	1656.4Mb	16.4M	37.0%	90.6%	37.2%	141.0bp	74.8%	36.0%	114bp	141bp	36%	16.4M
RZZ015LA3	0.80	2.1M	1.2M	0.5M	0.2M	0.2M	0.95%	0.7M	2.1M	100.0%	0.0%	2.8%	2.1M	0.0bp	2.7M	2.7M	100.0%	9.6%	12.7M	12.2M	95.8%	11.3M	89.4%	0.8M	2.7M	18.3%	66.0%	37.0%	151bp	151bp	36%	15.8M	86.9%	1382.2Mb	14.0M	35.8%	89.1%	35.8%	141.0bp	79.4%	35.0%	113bp	141bp	36%	14.0M
RZZ015LA4	0.87	2.6M	1.4M	0.7M	0.2M	0.2M	0.93%	1.0M	2.6M	100.0%	0.0%	3.3%	2.6M	0.0bp	3.5M	3.5M	100.0%	6.1%	14.8M	14.1M	95.5%	12.9M	87.5%	1.2M	3.5M	20.0%	63.9%	40.0%	151bp	151bp	36%	18.6M	88.3%	1496.8Mb	15.7M	36.9%	84.7%	46.0%	141.0bp	78.2%	36.0%	108bp	132bp	36%	15.7M
RZZ015LA5	0.82	3.5M	1.9M	1.0M	0.3M	0.3M	0.94%	1.3M	3.5M	100.0%	0.0%	3.1%	3.5M	0.0bp	4.8M	4.8M	100.0%	8.3%	17.5M	16.5M	94.0%	15.3M	87.1%	1.2M	4.8M	23.3%	55.9%	40.0%	151bp	151bp	27%	25.6M	86.8%	1820.2Mb	19.1M	35.7%	74.6%	47.8%	141.0bp	74.5%	35.0%	110bp	137bp	36%	19.1M
RZZ015LA6	0.65	2.7M	1.5M	0.7M	0.2M	0.2M	0.93%	0.9M	2.7M	100.0%	0.0%	3.0%	2.7M	0.0bp	3.6M	3.6M	100.0%	8.1%	16.0M	15.3M	95.8%	14.1M	88.7%	1.1M	3.6M	18.9%	66.4%	38.0%	151bp	151bp	36%	19.7M	88.1%	1679.5Mb	17.4M	36.2%	87.9%	41.6%	141.0bp	79.3%	36.0%	110bp	137bp	36%	17.4M
RZZ016HA1	0.73	2.5M	1.4M	0.6M	0.2M	0.2M	0.95%	0.8M	2.5M	100.0%	0.0%	2.9%	2.5M	0.0bp	3.3M	3.3M	100.0%	8.6%	15.3M	14.6M	96.0%	13.7M	89.6%	1.0M	3.3M	18.5%	65.0%	37.0%	151bp	151bp	27%	18.7M	87.5%	1668.5Mb	16.7M	36.2%	89.4%	36.7%	141.0bp	79.7%	36.0%	114bp	141bp	36%	16.7M
RZZ016HA2	0.77	2.7M	1.5M	0.7M	0.2M	0.2M	0.94%	1.0M	2.7M	100.0%	0.0%	3.0%	2.7M	0.0bp	3.7M	3.7M	100.0%	7.5%	16.9M	16.2M	95.8%	15.1M	89.2%	1.1M	3.7M	18.6%	65.4%	39.0%	151bp	151bp	36%	21.0M	88.1%	1754.5Mb	18.3M	36.8%	86.8%	43.7%	141.0bp	79.6%	36.0%	109bp	137bp	36%	18.3M
RZZ016HA3	0.66	2.4M	1.3M	0.6M	0.2M	0.2M	0.97%	0.9M	2.4M	100.0%	0.0%	3.1%	2.4M	0.0bp	3.3M	3.3M	100.0%	8.8%	15.7M	15.0M	95.3%	13.9M	88.6%	1.1M	3.3M	17.6%	64.8%	37.0%	151bp	151bp	27%	19.8M	87.1%	1679.9Mb	17.2M	35.7%	86.9%	39.9%	141.0bp	79.8%	35.0%	112bp	141bp	36%	17.2M
RZZ016HA4	0.80	2.3M	1.3M	0.6M	0.2M	0.2M	0.93%	0.9M	2.3M	100.0%	0.0%	3.4%	2.3M	0.0bp	3.2M	3.2M	100.0%	9.2%	13.7M	13.0M	94.8%	11.9M	87.1%	1.0M	3.2M	19.3%	62.5%	41.0%	151bp	151bp	36%	18.8M	87.2%	1409.3Mb	15.1M	36.6%	80.4%	47.5%	141.0bp	78.5%	36.0%	107bp	132bp	36%	15.1M
RZZ016HA5	1.10	3.0M	1.6M	0.8M	0.3M	0.2M	0.97%	1.3M	3.0M	100.0%	0.0%	3.8%	3.0M	0.0bp	4.2M	4.2M	100.0%	7.9%	14.0M	13.0M	93.3%	11.8M	84.2%	1.3M	4.2M	23.5%	53.7%	42.0%	151bp	151bp	36%	21.6M	85.9%	1328.4Mb	15.2M	35.6%	70.1%	56.2%	141.0bp	72.6%	35.0%	102bp	122bp	36%	15.2M
RZZ016HA6	0.69	1.6M	0.9M	0.4M	0.1M	0.1M	0.92%	0.7M	1.6M	100.0%	0.0%	3.5%	1.6M	0.0bp	2.3M	2.3M	100.0%	10.6%	12.4M	11.9M	95.8%	10.9M	87.7%	1.0M	2.3M	15.5%	70.3%	38.0%	151bp	151bp	36%	15.7M	87.7%	1327.3Mb	13.9M	36.3%	88.5%	41.7%	141.0bp	82.4%	36.0%	109bp	137bp	45%	13.9M
RZZ016LA1	0.74	3.1M	1.6M	0.9M	0.3M	0.2M	1.00%	1.2M	3.1M	100.0%	0.0%	3.5%	3.1M	0.0bp	4.3M	4.3M	100.0%	6.8%	12.8M	11.9M	92.7%	10.9M	85.0%	1.0M	4.3M	27.9%	50.8%	44.0%	151bp	151bp	36%	20.0M	86.3%	1258.3Mb	13.7M	36.2%	68.7%	53.4%	141.0bp	69.1%	36.0%	106bp	132bp	36%	13.7M
RZZ016LA2	0.85	2.8M	1.6M	0.8M	0.2M	0.2M	0.93%	0.7M	2.8M	100.0%	0.0%	2.2%	2.8M	0.0bp	3.5M	3.5M	100.0%	7.7%	12.9M	12.4M	96.3%	11.7M	90.8%	0.7M	3.5M	24.0%	61.5%	37.0%	151bp	151bp	36%	15.2M	88.4%	1412.2Mb	14.0M	36.6%	92.0%	35.7%	141.0bp	75.2%	36.0%	114bp	141bp	36%	14.0M
RZZ016LA3	0.79	2.9M	1.6M	0.8M	0.2M	0.2M	0.96%	0.9M	2.9M	100.0%	0.0%	2.9%	2.9M	0.0bp	3.8M	3.8M	100.0%	8.8%	16.7M	16.0M	95.6%	14.8M	88.6%	1.2M	3.8M	19.2%	64.9%	37.0%	151bp	151bp	27%	20.4M	87.0%	1818.8Mb	18.3M	35.8%	89.9%	36.1%	141.0bp	78.5%	35.0%	114bp	141bp	36%	18.3M
RZZ016LA4	0.73	3.2M	1.8M	0.8M	0.3M	0.2M	0.90%	1.0M	3.2M	100.0%	0.0%	2.8%	3.2M	0.0bp	4.2M	4.2M	100.0%	8.4%	16.5M	15.8M	95.6%	14.9M	90.0%	0.9M	4.2M	21.8%	63.1%	38.0%	151bp	151bp	27%	20.9M	87.8%	1754.2Mb	18.0M	36.2%	86.4%	40.8%	141.0bp	76.7%	36.0%	111bp	137bp	36%	18.0M
RZZ016LA5	0.73	2.5M	1.5M	0.7M	0.2M	0.2M	0.93%	0.8M	2.5M	100.0%	0.0%	2.6%	2.5M	0.0bp	3.3M	3.3M	100.0%	7.4%	14.2M	13.6M	96.1%	12.9M	90.7%	0.8M	3.3M	20.5%	62.6%	38.0%	151bp	151bp	27%	17.0M	87.7%	1549.5Mb	15.3M	37.3%	90.1%	36.3%	141.0bp	77.9%	37.0%	115bp	141bp	36%	15.3M
RZZ016LA6	0.78	2.7M	1.6M	0.7M	0.2M	0.2M	0.91%	0.8M	2.7M	100.0%	0.0%	2.5%	2.7M	0.0bp	3.4M	3.4M	100.0%	8.4%	13.9M	13.4M	96.4%	12.5M	89.8%	0.9M	3.4M	21.3%	65.5%	37.0%	151bp	151bp	36%	16.5M	88.4%	1515.5Mb	15.2M	36.2%	91.9%	35.7%	141.0bp	77.4%	36.0%	113bp	141bp	36%	15.2M
RZZ017HA1	0.74	2.2M	1.3M	0.5M	0.2M	0.2M	0.96%	0.8M	2.2M	100.0%	0.0%	3.3%	2.2M	0.0bp	3.0M	3.0M	100.0%	9.6%	14.5M	13.8M	95.4%	12.7M	88.1%	1.1M	3.0M	17.4%	66.1%	38.0%	151bp	151bp	36%	18.1M	87.0%	1584.1Mb	16.0M	36.3%	88.3%	37.0%	141.0bp	80.2%	36.0%	114bp	141bp	36%	16.0M
RZZ017HA2	0.68	2.6M	1.4M	0.7M	0.2M	0.2M	0.93%	1.1M	2.6M	100.0%	0.0%	3.7%	2.6M	0.0bp	3.7M	3.7M	100.0%	6.5%	19.2M	18.0M	93.6%	16.7M	86.8%	1.3M	3.7M	16.4%	67.1%	40.0%	151bp	151bp	27%	25.7M	88.1%	1938.4Mb	20.5M	36.2%	79.7%	48.6%	141.0bp	81.4%	36.0%	107bp	132bp	36%	20.5M
RZZ017HA3	0.82	2.3M	1.3M	0.6M	0.2M	0.2M	0.96%	0.9M	2.3M	100.0%	0.0%	3.3%	2.3M	0.0bp	3.2M	3.2M	100.0%	7.2%	15.3M	14.7M	95.6%	13.2M	86.3%	1.4M	3.2M	16.9%	65.5%	39.0%	151bp	151bp	27%	19.1M	87.3%	1589.1Mb	16.5M	36.6%	86.6%	42.9%	141.0bp	80.1%	36.0%	110bp	137bp	36%	16.5M
RZZ017HA4	0.71	3.0M	1.6M	0.8M	0.2M	0.2M	0.96%	1.2M	3.0M	100.0%	0.0%	3.4%	3.0M	0.0bp	4.2M	4.2M	100.0%	5.8%	14.9M	14.1M	94.7%	12.9M	86.3%	1.2M	4.2M	23.2%	57.9%	42.0%	151bp	151bp	36%	20.3M	87.8%	1456.4Mb	15.8M	36.8%	77.9%	51.2%	141.0bp	74.7%	36.0%	105bp	127bp	36%	15.8M
RZZ017HA5	0.70	2.0M	1.2M	0.5M	0.2M	0.2M	0.95%	0.6M	2.0M	100.0%	0.0%	2.7%	2.0M	0.0bp	2.7M	2.7M	100.0%	9.5%	13.3M	12.7M	96.1%	12.0M	90.4%	0.8M	2.7M	17.5%	67.6%	37.0%	151bp	151bp	36%	16.0M	87.3%	1486.7Mb	14.6M	36.3%	91.4%	32.6%	141.0bp	80.6%	36.0%	116bp	141bp	36%	14.6M
RZZ017HA6	0.68	1.8M	1.1M	0.4M	0.1M	0.1M	0.90%	0.6M	1.8M	100.0%	0.0%	2.9%	1.8M	0.0bp	2.4M	2.4M	100.0%	9.8%	13.6M	13.0M	95.7%	11.8M	86.9%	1.2M	2.4M	14.8%	72.1%	40.0%	151bp	151bp	36%	17.5M	88.1%	1472.8Mb	15.1M	37.1%	86.0%	41.7%	141.0bp	82.9%	37.0%	111bp	137bp	36%	15.1M
RZZ017LA1	0.77	2.6M	1.4M	0.7M	0.2M	0.2M	0.94%	0.9M	2.6M	100.0%	0.0%	3.1%	2.6M	0.0bp	3.5M	3.5M	100.0%	7.2%	14.2M	13.5M	95.5%	12.5M	88.0%	1.1M	3.5M	20.4%	62.1%	40.0%	151bp	151bp	36%	17.8M	87.5%	1498.7Mb	15.3M	36.8%	86.0%	40.9%	141.0bp	77.1%	36.0%	112bp	141bp	27%	15.3M
RZZ017LA2	0.77	2.6M	1.5M	0.7M	0.2M	0.2M	0.92%	0.7M	2.6M	100.0%	0.0%	2.4%	2.6M	0.0bp	3.3M	3.3M	100.0%	7.7%	13.9M	13.4M	96.5%	12.6M	90.4%	0.8M	3.3M	20.9%	65.8%	37.0%	151bp	151bp	36%	16.2M	88.3%	1514.3Mb	15.1M	36.7%	92.9%	35.8%	141.0bp	77.9%	36.0%	114bp	141bp	36%	15.1M
RZZ017LA3	0.78	2.6M	1.5M	0.7M	0.2M	0.2M	0.93%	0.9M	2.6M	100.0%	0.0%	2.8%	2.6M	0.0bp	3.5M	3.5M	100.0%	8.4%	14.6M	14.0M	96.0%	13.0M	89.5%	1.0M	3.5M	20.3%	63.3%	38.0%	151bp	151bp	36%	17.8M	87.5%	1565.8Mb	15.9M	36.4%	89.4%	38.1%	141.0bp	78.0%	36.0%	113bp	141bp	36%	15.9M
RZZ017LA4	0.91	2.5M	1.4M	0.7M	0.2M	0.2M	0.92%	0.9M	2.5M	100.0%	0.0%	3.0%	2.5M	0.0bp	3.3M	3.3M	100.0%	5.9%	12.7M	12.1M	95.4%	11.4M	89.8%	0.7M	3.3M	22.3%	62.2%	38.0%	151bp	151bp	27%	15.9M	88.4%	1308.5Mb	13.5M	36.4%	84.9%	44.4%	141.0bp	76.3%	36.0%	109bp	137bp	36%	13.5M
RZZ017LA5	0.79	2.6M	1.6M	0.7M	0.2M	0.2M	0.93%	0.7M	2.6M	100.0%	0.0%	2.3%	2.6M	0.0bp	3.4M	3.4M	100.0%	9.4%	14.2M	13.6M	96.3%	12.9M	91.0%	0.8M	3.4M	20.9%	63.8%	36.0%	151bp	151bp	27%	16.9M	87.4%	1600.9Mb	15.6M	36.2%	92.4%	31.4%	141.0bp	77.6%	36.0%	117bp	141bp	36%	15.6M
RZZ017LA6	0.69	2.0M	1.2M	0.5M	0.2M	0.2M	0.94%	0.5M	2.0M	100.0%	0.0%	1.9%	2.0M	0.0bp	2.5M	2.5M	100.0%	4.6%	14.7M	14.3M	97.1%	13.7M	92.9%	0.6M	2.5M	15.3%	75.1%	38.0%	151bp	151bp	27%	16.0M	91.3%	1805.6Mb	15.5M	38.8%	96.5%	18.9%	141.0bp	83.5%	38.0%	128bp	141bp	27%	15.5M
RZZ018HA1	0.64	2.7M	1.6M	0.7M	0.2M	0.2M	0.94%	0.9M	2.7M	100.0%	0.0%	2.9%	2.7M	0.0bp	3.7M	3.7M	100.0%	10.0%	12.8M	12.2M	94.8%	11.2M	87.2%	1.0M	3.7M	23.5%	57.2%	39.0%	151bp	151bp	36%	17.2M	86.8%	1387.5Mb	14.3M	36.2%	82.8%	40.9%	141.0bp	74.0%	36.0%	112bp	141bp	36%	14.3M
RZZ018HA2	0.65	3.0M	1.7M	0.8M	0.2M	0.2M	0.93%	0.9M	3.0M	100.0%	0.0%	2.6%	3.0M	0.0bp	3.9M	3.9M	100.0%	7.6%	14.9M	14.3M	96.0%	13.4M	90.4%	0.8M	3.9M	22.8%	61.4%	38.0%	151bp	151bp	27%	18.4M	88.8%	1585.4Mb	16.1M	36.8%	87.2%	41.9%	141.0bp	76.5%	36.0%	111bp	141bp	36%	16.1M
RZZ018HA3	0.75	3.1M	1.8M	0.8M	0.3M	0.2M	0.97%	1.0M	3.1M	100.0%	0.0%	2.8%	3.1M	0.0bp	4.1M	4.1M	100.0%	8.9%	18.1M	17.3M	95.7%	16.1M	89.2%	1.2M	4.1M	19.5%	64.8%	36.0%	151bp	151bp	27%	22.0M	87.6%	1980.8Mb	19.8M	35.8%	90.2%	36.0%	141.0bp	78.8%	35.0%	114bp	141bp	36%	19.8M
RZZ018HA4	0.56	3.0M	1.6M	0.9M	0.3M	0.2M	0.96%	0.9M	3.0M	100.0%	0.0%	2.6%	3.0M	0.0bp	4.0M	4.0M	100.0%	8.5%	15.6M	15.0M	96.1%	14.0M	89.6%	1.0M	4.0M	21.8%	65.4%	37.0%	151bp	151bp	27%	18.6M	88.6%	1716.0Mb	17.1M	36.3%	91.8%	37.2%	141.0bp	77.0%	36.0%	113bp	141bp	36%	17.1M
RZZ018HA5	0.62	3.1M	1.7M	0.8M	0.2M	0.2M	0.95%	1.0M	3.1M	100.0%	0.0%	2.7%	3.1M	0.0bp	4.0M	4.0M	100.0%	9.7%	12.3M	11.8M	95.4%	10.9M	88.1%	0.9M	4.0M	27.2%	53.3%	37.0%	151bp	151bp	27%	15.6M	86.8%	1341.3Mb	13.7M	35.8%	87.8%	38.0%	141.0bp	70.7%	35.0%	113bp	141bp	36%	13.7M
RZZ018HA6	0.65	2.7M	1.5M	0.7M	0.2M	0.2M	0.93%	0.9M	2.7M	100.0%	0.0%	2.9%	2.7M	0.0bp	3.6M	3.6M	100.0%	8.2%	17.9M	17.1M	95.8%	15.9M	89.1%	1.2M	3.6M	17.3%	69.2%	37.0%	151bp	151bp	36%	21.9M	88.3%	1922.3Mb	19.5M	36.0%	88.7%	38.7%	141.0bp	81.0%	35.0%	112bp	141bp	36%	19.5M
RZZ018LA1	0.85	2.2M	1.3M	0.6M	0.2M	0.2M	0.94%	0.7M	2.2M	100.0%	0.0%	2.6%	2.2M	0.0bp	2.8M	2.8M	100.0%	8.3%	12.5M	12.0M	96.1%	11.2M	90.0%	0.8M	2.8M	19.8%	64.6%	37.0%	151bp	151bp	27%	14.8M	87.6%	1391.5Mb	13.6M	36.9%	91.7%	33.2%	141.0bp	78.3%	36.0%	117bp	141bp	36%	13.6M
RZZ018LA2	0.80	4.1M	2.3M	1.1M	0.3M	0.3M	0.92%	1.4M	4.1M	100.0%	0.0%	3.1%	4.1M	0.0bp	5.5M	5.5M	100.0%	7.5%	19.4M	18.5M	95.3%	17.3M	89.1%	1.2M	5.5M	23.5%	59.0%	38.0%	151bp	151bp	27%	25.1M	87.5%	1936.2Mb	21.0M	35.6%	83.5%	47.1%	141.0bp	74.6%	35.0%	106bp	127bp	36%	21.0M
RZZ018LA3	0.71	1.8M	1.1M	0.4M	0.1M	0.1M	0.92%	0.7M	1.8M	100.0%	0.0%	3.1%	1.8M	0.0bp	2.5M	2.5M	100.0%	9.6%	12.2M	11.7M	95.7%	10.8M	88.9%	0.8M	2.5M	17.2%	67.4%	37.0%	151bp	151bp	27%	15.0M	87.3%	1345.0Mb	13.5M	36.2%	89.9%	36.0%	141.0bp	80.8%	36.0%	114bp	141bp	36%	13.5M
RZZ018LA4	0.73	2.5M	1.3M	0.7M	0.2M	0.2M	0.92%	0.9M	2.5M	100.0%	0.0%	3.2%	2.5M	0.0bp	3.4M	3.4M	100.0%	7.3%	15.7M	15.0M	95.4%	13.7M	87.4%	1.3M	3.4M	18.0%	66.5%	39.0%	151bp	151bp	27%	19.9M	88.3%	1627.8Mb	16.9M	36.5%	85.2%	44.6%	141.0bp	79.8%	36.0%	109bp	137bp	36%	16.9M
RZZ018LA5	0.80	2.6M	1.6M	0.6M	0.2M	0.2M	0.94%	0.7M	2.6M	100.0%	0.0%	2.3%	2.6M	0.0bp	3.3M	3.3M	100.0%	9.9%	12.2M	11.7M	96.1%	11.0M	90.4%	0.7M	3.3M	23.8%	60.2%	37.0%	151bp	151bp	27%	14.9M	87.3%	1376.3Mb	13.5M	35.9%	90.6%	31.4%	141.0bp	75.0%	35.0%	116bp	141bp	36%	13.5M
RZZ018LA6	0.81	2.7M	1.5M	0.7M	0.2M	0.2M	0.94%	0.9M	2.7M	100.0%	0.0%	2.9%	2.7M	0.0bp	3.6M	3.6M	100.0%	7.3%	16.7M	16.0M	95.8%	14.9M	89.0%	1.1M	3.6M	18.2%	67.3%	38.0%	151bp	151bp	36%	20.7M	88.2%	1753.9Mb	18.1M	36.1%	87.1%	41.6%	141.0bp	79.9%	36.0%	110bp	137bp	36%	18.1M
RZZ019HA1	0.57	1.9M	1.1M	0.5M	0.1M	0.1M	0.93%	0.6M	1.9M	100.0%	0.0%	2.8%	1.9M	0.0bp	2.6M	2.6M	100.0%	10.6%	10.7M	10.3M	95.8%	9.5M	88.4%	0.8M	2.6M	20.1%	64.2%	37.0%	151bp	151bp	27%	13.3M	87.0%	1206.1Mb	12.0M	35.7%	90.1%	33.7%	141.0bp	77.7%	35.0%	115bp	141bp	27%	12.0M
RZZ019HA2	0.69	2.1M	1.3M	0.5M	0.2M	0.2M	0.91%	0.7M	2.1M	100.0%	0.0%	2.7%	2.1M	0.0bp	2.8M	2.8M	100.0%	8.7%	12.0M	11.5M	96.1%	10.8M	90.0%	0.7M	2.8M	20.3%	64.9%	38.0%	151bp	151bp	36%	14.8M	87.9%	1289.6Mb	13.1M	36.2%	88.8%	38.6%	141.0bp	78.0%	36.0%	112bp	141bp	36%	13.1M
RZZ019HA3	0.89	3.5M	1.9M	1.0M	0.3M	0.3M	0.97%	1.1M	3.5M	100.0%	0.0%	2.7%	3.5M	0.0bp	4.5M	4.5M	100.0%	7.9%	13.4M	12.8M	95.7%	11.8M	88.3%	1.0M	4.5M	28.2%	52.3%	38.0%	151bp	151bp	27%	16.5M	86.9%	1407.5Mb	14.5M	36.2%	88.3%	39.9%	141.0bp	69.8%	36.0%	112bp	137bp	36%	14.5M
RZZ019HA4	0.84	2.2M	1.2M	0.5M	0.2M	0.2M	0.90%	0.8M	2.2M	100.0%	0.0%	3.0%	2.2M	0.0bp	2.9M	2.9M	100.0%	9.3%	14.3M	13.7M	95.9%	12.6M	88.3%	1.1M	2.9M	17.2%	69.0%	38.0%	151bp	151bp	36%	17.8M	88.1%	1545.9Mb	15.7M	36.4%	88.5%	38.7%	141.0bp	80.9%	36.0%	112bp	141bp	36%	15.7M
RZZ019HA5	0.54	1.7M	1.0M	0.4M	0.1M	0.1M	0.92%	0.5M	1.7M	100.0%	0.0%	2.7%	1.7M	0.0bp	2.2M	2.2M	100.0%	11.5%	8.5M	8.1M	95.6%	7.5M	88.3%	0.6M	2.2M	21.7%	60.9%	37.0%	151bp	151bp	27%	10.9M	86.6%	946.8Mb	9.6M	35.8%	87.8%	34.8%	141.0bp	75.8%	35.0%	114bp	141bp	36%	9.6M
RZZ019HA6	0.71	2.6M	1.5M	0.7M	0.2M	0.2M	0.91%	0.9M	2.6M	100.0%	0.0%	2.9%	2.6M	0.0bp	3.5M	3.5M	100.0%	8.6%	13.2M	12.6M	95.8%	11.3M	86.1%	1.3M	3.5M	21.8%	61.3%	38.0%	151bp	151bp	36%	16.6M	88.0%	1389.8Mb	14.4M	36.2%	87.0%	41.9%	141.0bp	76.0%	36.0%	110bp	137bp	36%	14.4M
RZZ019LA1	0.86	2.7M	1.4M	0.8M	0.2M	0.2M	0.96%	1.1M	2.7M	100.0%	0.0%	3.6%	2.7M	0.0bp	3.8M	3.8M	100.0%	9.3%	11.4M	10.6M	93.0%	9.7M	84.8%	0.9M	3.8M	26.8%	52.2%	43.0%	151bp	151bp	36%	17.1M	86.0%	1165.6Mb	12.6M	36.4%	73.6%	49.3%	141.0bp	70.0%	36.0%	108bp	137bp	36%	12.6M
RZZ019LA2	0.90	2.0M	1.1M	0.5M	0.2M	0.2M	0.90%	0.6M	2.0M	100.0%	0.0%	2.4%	2.0M	0.0bp	2.6M	2.6M	100.0%	8.5%	7.5M	7.2M	96.3%	6.7M	89.8%	0.5M	2.6M	29.6%	53.6%	38.0%	151bp	151bp	36%	9.0M	88.2%	805.3Mb	8.2M	36.4%	90.3%	38.6%	141.0bp	69.3%	36.0%	112bp	141bp	36%	8.2M
RZZ019LA3	0.85	3.0M	1.7M	0.8M	0.2M	0.2M	0.97%	1.0M	3.0M	100.0%	0.0%	2.7%	3.0M	0.0bp	4.0M	4.0M	100.0%	8.9%	13.1M	12.6M	95.6%	11.6M	88.5%	0.9M	4.0M	25.1%	57.1%	38.0%	151bp	151bp	27%	16.1M	87.0%	1423.3Mb	14.4M	36.2%	89.7%	36.8%	141.0bp	72.6%	36.0%	113bp	141bp	36%	14.4M
RZZ019LA4	0.80	3.1M	1.7M	0.8M	0.2M	0.2M	0.93%	1.1M	3.1M	100.0%	0.0%	3.0%	3.1M	0.0bp	4.2M	4.2M	100.0%	7.1%	18.4M	17.6M	95.5%	16.3M	88.6%	1.3M	4.2M	19.2%	65.3%	39.0%	151bp	151bp	27%	23.1M	88.3%	1919.0Mb	19.8M	36.4%	85.8%	43.0%	141.0bp	78.9%	36.0%	110bp	137bp	36%	19.8M
RZZ019LA5	0.79	3.5M	2.0M	0.9M	0.3M	0.3M	0.92%	0.9M	3.5M	100.0%	0.0%	2.3%	3.5M	0.0bp	4.4M	4.4M	100.0%	8.6%	18.6M	17.8M	95.8%	16.7M	89.8%	1.1M	4.4M	21.2%	62.1%	37.0%	151bp	151bp	27%	22.8M	87.8%	2102.8Mb	20.3M	36.3%	89.1%	32.8%	141.0bp	77.7%	36.0%	118bp	141bp	36%	20.3M
RZZ019LA6	0.74	2.5M	1.4M	0.7M	0.2M	0.2M	0.91%	0.7M	2.5M	100.0%	0.0%	2.4%	2.5M	0.0bp	3.2M	3.2M	100.0%	7.8%	9.4M	9.1M	96.2%	8.4M	89.2%	0.7M	3.2M	28.7%	54.9%	37.0%	151bp	151bp	36%	11.3M	88.5%	1012.1Mb	10.2M	36.2%	90.4%	38.8%	141.0bp	70.2%	36.0%	112bp	141bp	36%	10.2M
RZZ035HA1	0.86	2.6M	1.5M	0.7M	0.2M	0.2M	0.92%	0.9M	2.6M	100.0%	0.0%	2.9%	2.6M	0.0bp	3.5M	3.5M	100.0%	7.7%	14.8M	14.2M	95.7%	13.1M	88.5%	1.1M	3.5M	19.9%	62.9%	38.0%	151bp	151bp	27%	18.5M	87.9%	1589.3Mb	16.0M	36.3%	86.8%	39.9%	141.0bp	78.1%	36.0%	113bp	141bp	36%	16.0M
RZZ035HA2	0.77	2.9M	1.7M	0.7M	0.2M	0.2M	0.91%	0.9M	2.9M	100.0%	0.0%	2.7%	2.9M	0.0bp	3.9M	3.9M	100.0%	8.5%	12.5M	12.0M	96.1%	10.9M	86.9%	1.1M	3.9M	25.4%	58.2%	37.0%	151bp	151bp	36%	15.2M	87.9%	1336.8Mb	13.6M	36.0%	89.8%	38.4%	141.0bp	72.7%	35.0%	111bp	137bp	36%	13.6M
RZZ035HA3	0.74	2.8M	1.6M	0.8M	0.2M	0.2M	0.94%	0.9M	2.8M	100.0%	0.0%	2.8%	2.8M	0.0bp	3.7M	3.7M	100.0%	7.2%	13.9M	13.3M	95.9%	12.4M	89.1%	0.9M	3.7M	22.6%	58.9%	38.0%	151bp	151bp	27%	17.2M	87.5%	1469.9Mb	15.0M	36.6%	87.1%	40.3%	141.0bp	75.5%	36.0%	112bp	141bp	36%	15.0M
RZZ035HA4	0.77	1.3M	0.7M	0.3M	0.1M	0.1M	0.93%	0.6M	1.3M	100.0%	0.0%	3.9%	1.3M	0.0bp	1.9M	1.9M	100.0%	8.9%	11.2M	10.6M	94.5%	9.9M	87.6%	0.8M	1.9M	14.3%	70.0%	40.0%	151bp	151bp	36%	15.2M	87.6%	1178.9Mb	12.3M	36.7%	81.2%	45.4%	141.0bp	83.0%	36.0%	109bp	137bp	36%	12.3M
RZZ035HA5	0.74	2.8M	1.6M	0.7M	0.2M	0.2M	0.92%	0.8M	2.8M	100.0%	0.0%	2.5%	2.8M	0.0bp	3.6M	3.6M	100.0%	9.0%	16.7M	16.0M	95.8%	14.7M	88.4%	1.2M	3.6M	18.9%	63.6%	38.0%	151bp	151bp	27%	21.1M	87.9%	1853.7Mb	18.3M	36.8%	86.8%	36.9%	141.0bp	79.5%	36.0%	115bp	141bp	36%	18.3M
RZZ035HA6	0.83	2.6M	1.5M	0.7M	0.2M	0.2M	0.92%	0.8M	2.6M	100.0%	0.0%	2.7%	2.6M	0.0bp	3.4M	3.4M	100.0%	7.6%	13.1M	12.6M	96.3%	11.7M	89.2%	0.9M	3.4M	21.8%	64.9%	36.0%	151bp	151bp	27%	15.4M	88.5%	1408.5Mb	14.2M	36.0%	92.0%	38.4%	141.0bp	76.8%	36.0%	112bp	141bp	36%	14.2M
RZZ035LA1	0.71	2.4M	1.4M	0.6M	0.2M	0.2M	0.95%	0.8M	2.4M	100.0%	0.0%	2.8%	2.4M	0.0bp	3.2M	3.2M	100.0%	9.6%	12.7M	12.2M	95.6%	11.3M	89.1%	0.8M	3.2M	21.6%	62.1%	37.0%	151bp	151bp	36%	15.8M	87.1%	1399.9Mb	14.1M	35.9%	88.8%	35.7%	141.0bp	76.5%	35.0%	114bp	141bp	36%	14.1M
RZZ035LA2	0.78	2.3M	1.3M	0.6M	0.2M	0.2M	0.92%	0.6M	2.3M	100.0%	0.0%	2.1%	2.3M	0.0bp	2.8M	2.8M	100.0%	8.4%	8.8M	8.5M	96.4%	8.0M	91.1%	0.5M	2.8M	28.5%	54.9%	38.0%	151bp	151bp	36%	10.6M	88.3%	965.1Mb	9.6M	36.9%	90.6%	35.4%	141.0bp	70.9%	36.0%	114bp	141bp	36%	9.6M
RZZ035LA3	0.72	2.4M	1.4M	0.6M	0.2M	0.2M	0.94%	0.8M	2.4M	100.0%	0.0%	3.1%	2.4M	0.0bp	3.2M	3.2M	100.0%	8.8%	17.7M	17.0M	95.7%	15.8M	89.2%	1.2M	3.2M	15.5%	68.5%	38.0%	151bp	151bp	36%	22.1M	87.4%	1926.7Mb	19.4M	36.2%	88.0%	37.4%	141.0bp	82.4%	36.0%	113bp	141bp	36%	19.4M
RZZ035LA4	0.75	2.5M	1.3M	0.7M	0.2M	0.2M	0.95%	0.9M	2.5M	100.0%	0.0%	3.1%	2.5M	0.0bp	3.4M	3.4M	100.0%	5.4%	13.6M	13.0M	95.6%	12.0M	88.1%	1.0M	3.4M	20.9%	63.5%	39.0%	151bp	151bp	36%	16.5M	88.4%	1370.1Mb	14.3M	36.6%	86.9%	45.5%	141.0bp	77.1%	36.0%	108bp	137bp	36%	14.3M
RZZ035LA5	0.74	3.8M	2.1M	1.1M	0.3M	0.3M	0.94%	1.1M	3.8M	100.0%	0.0%	2.6%	3.8M	0.0bp	4.9M	4.9M	100.0%	8.4%	15.2M	14.3M	94.4%	13.5M	88.7%	0.9M	4.9M	28.3%	50.0%	42.0%	151bp	151bp	27%	21.4M	86.6%	1598.5Mb	16.6M	37.2%	77.5%	44.6%	141.0bp	70.3%	37.0%	111bp	137bp	36%	16.6M
RZZ035LA6	0.61	2.5M	1.4M	0.7M	0.2M	0.2M	0.91%	0.8M	2.5M	100.0%	0.0%	2.6%	2.5M	0.0bp	3.3M	3.3M	100.0%	8.8%	11.0M	10.5M	95.9%	9.8M	89.4%	0.7M	3.3M	25.9%	56.4%	38.0%	151bp	151bp	36%	14.0M	87.9%	1158.4Mb	12.0M	36.0%	86.3%	41.8%	141.0bp	73.0%	36.0%	109bp	137bp	36%	12.0M
RZZ074HA1	0.69	2.7M	1.5M	0.7M	0.2M	0.2M	0.93%	0.9M	2.7M	100.0%	0.0%	2.9%	2.7M	0.0bp	3.6M	3.6M	100.0%	9.3%	13.3M	12.7M	95.5%	11.7M	88.4%	0.9M	3.6M	22.5%	60.5%	37.0%	151bp	151bp	27%	16.5M	87.4%	1446.7Mb	14.6M	36.0%	88.8%	37.7%	141.0bp	75.7%	35.0%	113bp	141bp	36%	14.6M
RZZ074HA2	0.71	3.1M	1.6M	0.9M	0.3M	0.2M	0.96%	1.1M	3.1M	100.0%	0.0%	3.2%	3.1M	0.0bp	4.2M	4.2M	100.0%	7.3%	16.0M	15.1M	94.7%	13.9M	86.9%	1.2M	4.2M	22.0%	60.0%	41.0%	151bp	151bp	27%	21.8M	87.6%	1611.9Mb	17.2M	36.7%	78.9%	48.5%	141.0bp	75.6%	36.0%	107bp	132bp	36%	17.2M
RZZ074HA3	0.69	1.3M	0.8M	0.3M	0.1M	0.1M	0.94%	0.5M	1.3M	100.0%	0.0%	3.5%	1.3M	0.0bp	1.9M	1.9M	100.0%	8.9%	10.2M	9.6M	94.3%	8.8M	86.7%	0.8M	1.9M	15.2%	66.8%	40.0%	151bp	151bp	27%	14.6M	86.7%	1067.8Mb	11.2M	35.9%	76.7%	45.4%	141.0bp	81.4%	35.0%	110bp	137bp	27%	11.2M
RZZ074HA4	0.70	2.4M	1.3M	0.7M	0.2M	0.2M	0.92%	0.9M	2.4M	100.0%	0.0%	3.3%	2.4M	0.0bp	3.3M	3.3M	100.0%	5.5%	16.0M	15.3M	95.7%	14.1M	88.4%	1.2M	3.3M	17.6%	66.4%	39.0%	151bp	151bp	27%	20.1M	88.9%	1598.8Mb	16.9M	36.8%	83.9%	48.1%	141.0bp	80.5%	36.0%	107bp	132bp	36%	16.9M
RZZ074HA5	0.75	3.3M	1.9M	0.9M	0.3M	0.3M	0.93%	1.0M	3.3M	100.0%	0.0%	2.5%	3.3M	0.0bp	4.2M	4.2M	100.0%	7.8%	14.9M	14.3M	95.9%	13.4M	90.0%	0.9M	4.2M	24.8%	57.4%	38.0%	151bp	151bp	27%	18.3M	87.8%	1635.6Mb	16.2M	37.0%	88.3%	36.9%	141.0bp	74.3%	37.0%	115bp	141bp	36%	16.2M
RZZ074HA6	0.79	2.6M	1.5M	0.7M	0.2M	0.2M	0.94%	0.9M	2.6M	100.0%	0.0%	3.0%	2.6M	0.0bp	3.5M	3.5M	100.0%	7.9%	13.7M	13.1M	95.9%	12.0M	87.8%	1.1M	3.5M	21.4%	62.6%	38.0%	151bp	151bp	36%	16.7M	87.9%	1433.2Mb	14.9M	36.5%	89.2%	42.0%	141.0bp	76.6%	36.0%	110bp	137bp	36%	14.9M
RZZ074LA1	0.77	2.2M	1.2M	0.5M	0.2M	0.2M	0.95%	0.8M	2.2M	100.0%	0.0%	3.4%	2.2M	0.0bp	3.0M	3.0M	100.0%	7.2%	15.5M	14.8M	95.1%	13.7M	88.3%	1.1M	3.0M	16.2%	65.9%	39.0%	151bp	151bp	27%	19.8M	87.5%	1636.5Mb	16.8M	37.0%	84.5%	42.3%	141.0bp	80.9%	36.0%	112bp	141bp	36%	16.8M
RZZ074LA2	0.92	2.3M	1.3M	0.6M	0.2M	0.2M	0.91%	0.7M	2.3M	100.0%	0.0%	2.8%	2.3M	0.0bp	3.0M	3.0M	100.0%	7.5%	15.9M	15.2M	95.6%	14.4M	90.5%	0.8M	3.0M	16.6%	68.6%	39.0%	151bp	151bp	27%	20.5M	88.1%	1707.2Mb	17.2M	36.4%	84.2%	40.9%	141.0bp	81.5%	36.0%	113bp	141bp	36%	17.2M
RZZ074LA3	0.84	3.4M	1.9M	0.9M	0.3M	0.3M	0.95%	1.1M	3.4M	100.0%	0.0%	2.7%	3.4M	0.0bp	4.5M	4.5M	100.0%	8.6%	14.3M	13.7M	96.0%	12.7M	88.7%	1.0M	4.5M	26.2%	56.2%	36.0%	151bp	151bp	27%	17.1M	87.3%	1549.2Mb	15.6M	35.6%	91.6%	36.5%	141.0bp	72.2%	35.0%	113bp	141bp	36%	15.6M
RZZ074LA4	0.70	2.6M	1.4M	0.7M	0.2M	0.2M	0.90%	1.0M	2.6M	100.0%	0.0%	3.3%	2.6M	0.0bp	3.6M	3.6M	100.0%	8.8%	12.9M	12.3M	95.0%	11.2M	86.4%	1.1M	3.6M	22.3%	59.1%	41.0%	151bp	151bp	36%	17.3M	87.5%	1322.9Mb	14.2M	36.8%	81.7%	46.7%	141.0bp	75.3%	36.0%	107bp	132bp	36%	14.2M
RZZ074LA5	0.75	2.2M	1.3M	0.6M	0.2M	0.2M	0.94%	0.8M	2.2M	100.0%	0.0%	2.9%	2.2M	0.0bp	3.0M	3.0M	100.0%	8.2%	15.5M	14.9M	95.7%	14.0M	89.9%	0.9M	3.0M	16.8%	66.1%	39.0%	151bp	151bp	36%	19.3M	87.3%	1691.8Mb	16.9M	37.3%	87.8%	37.2%	141.0bp	81.0%	37.0%	114bp	141bp	36%	16.9M
RZZ074LA6	1.04	0.4M	0.3M	0.1M	0.0M	0.0M	0.78%	0.1M	0.4M	100.0%	0.0%	1.2%	0.4M	0.0bp	0.5M	0.5M	100.0%	5.6%	1.0M	0.9M	96.8%	0.9M	91.3%	0.1M	0.5M	46.9%	37.7%	43.0%	151bp	151bp	27%	1.1M	91.5%	120.3Mb	1.0M	43.1%	90.3%	20.7%	141.0bp	53.4%	43.0%	129bp	141bp	18%	1.0M
RZZ075HA1	0.72	2.9M	1.6M	0.8M	0.2M	0.2M	0.95%	1.0M	2.9M	100.0%	0.0%	3.0%	2.9M	0.0bp	4.0M	4.0M	100.0%	8.6%	13.6M	12.9M	94.9%	11.9M	87.3%	1.0M	4.0M	24.2%	56.0%	40.0%	151bp	151bp	27%	18.0M	86.7%	1432.8Mb	14.9M	36.3%	82.7%	42.8%	141.0bp	73.4%	36.0%	111bp	137bp	36%	14.9M
RZZ075HA2	0.84	2.5M	1.4M	0.6M	0.2M	0.2M	0.90%	0.7M	2.5M	100.0%	0.0%	2.3%	2.5M	0.0bp	3.1M	3.1M	100.0%	8.2%	12.6M	12.2M	96.6%	11.5M	91.4%	0.7M	3.1M	22.1%	64.5%	36.0%	151bp	151bp	36%	14.7M	88.9%	1412.5Mb	13.8M	36.4%	93.5%	34.1%	141.0bp	77.4%	36.0%	116bp	141bp	36%	13.8M
RZZ075HA3	0.71	2.0M	1.1M	0.5M	0.1M	0.1M	0.94%	0.7M	2.0M	100.0%	0.0%	3.0%	2.0M	0.0bp	2.6M	2.6M	100.0%	9.4%	12.4M	11.9M	95.9%	11.0M	88.5%	0.9M	2.6M	17.9%	66.5%	37.0%	151bp	151bp	36%	15.0M	87.1%	1356.0Mb	13.7M	36.5%	91.2%	36.2%	141.0bp	79.8%	36.0%	114bp	141bp	36%	13.7M
RZZ075HA4	0.87	2.2M	1.2M	0.6M	0.2M	0.2M	0.92%	0.9M	2.2M	100.0%	0.0%	3.6%	2.2M	0.0bp	3.1M	3.1M	100.0%	6.5%	14.3M	13.6M	95.1%	12.8M	89.1%	0.9M	3.1M	18.1%	65.4%	41.0%	151bp	151bp	36%	18.6M	87.7%	1428.2Mb	15.3M	37.1%	82.5%	48.4%	141.0bp	79.9%	37.0%	106bp	132bp	36%	15.3M
RZZ075HA5	0.67	2.2M	1.3M	0.6M	0.2M	0.2M	0.93%	0.7M	2.2M	100.0%	0.0%	2.7%	2.2M	0.0bp	2.9M	2.9M	100.0%	9.8%	12.2M	11.7M	96.0%	11.0M	90.1%	0.7M	2.9M	20.9%	62.3%	38.0%	151bp	151bp	36%	15.0M	87.4%	1350.0Mb	13.6M	36.6%	90.5%	36.3%	141.0bp	77.6%	36.0%	114bp	141bp	36%	13.6M
RZZ075HA6	0.74	2.8M	1.6M	0.8M	0.2M	0.2M	0.94%	1.0M	2.8M	100.0%	0.0%	3.0%	2.8M	0.0bp	3.8M	3.8M	100.0%	7.0%	13.2M	12.6M	95.5%	11.6M	88.0%	1.0M	3.8M	24.1%	57.8%	39.0%	151bp	151bp	36%	16.8M	87.8%	1349.3Mb	14.2M	36.4%	84.5%	44.9%	141.0bp	74.2%	36.0%	108bp	137bp	36%	14.2M
RZZ075LA1	1.01	3.1M	1.7M	0.9M	0.3M	0.2M	0.96%	1.2M	3.1M	100.0%	0.0%	3.3%	3.1M	0.0bp	4.3M	4.3M	100.0%	8.4%	12.1M	11.3M	93.3%	10.3M	85.0%	1.0M	4.3M	28.9%	48.8%	43.0%	151bp	151bp	27%	18.3M	85.8%	1216.0Mb	13.2M	36.2%	72.0%	50.1%	141.0bp	67.8%	36.0%	107bp	132bp	36%	13.2M
RZZ075LA2	0.86	2.2M	1.3M	0.6M	0.2M	0.2M	0.89%	0.6M	2.2M	100.0%	0.0%	2.5%	2.2M	0.0bp	2.8M	2.8M	100.0%	7.8%	8.0M	7.7M	96.3%	7.2M	90.2%	0.5M	2.8M	30.3%	53.1%	37.0%	151bp	151bp	36%	9.6M	88.4%	865.9Mb	8.7M	36.6%	90.5%	37.7%	141.0bp	69.2%	36.0%	113bp	141bp	36%	8.7M
RZZ075LA3	0.92	2.9M	1.6M	0.8M	0.2M	0.2M	0.94%	0.8M	2.9M	100.0%	0.0%	2.5%	2.9M	0.0bp	3.7M	3.7M	100.0%	9.4%	14.3M	13.8M	96.0%	12.9M	89.9%	0.9M	3.7M	22.3%	62.0%	36.0%	151bp	151bp	27%	17.2M	87.5%	1592.6Mb	15.8M	35.6%	91.9%	33.8%	141.0bp	76.2%	35.0%	115bp	141bp	36%	15.8M
RZZ075LA4	0.70	2.6M	1.5M	0.7M	0.2M	0.2M	0.90%	0.8M	2.6M	100.0%	0.0%	2.7%	2.6M	0.0bp	3.4M	3.4M	100.0%	8.8%	12.3M	11.8M	95.8%	10.9M	88.5%	0.9M	3.4M	23.1%	61.2%	37.0%	151bp	151bp	27%	15.1M	88.0%	1324.1Mb	13.4M	36.2%	89.0%	38.7%	141.0bp	75.2%	36.0%	112bp	141bp	36%	13.4M
RZZ075LA5	0.92	3.9M	2.1M	1.1M	0.3M	0.3M	0.93%	1.2M	3.9M	100.0%	0.0%	2.7%	3.9M	0.0bp	5.1M	5.1M	100.0%	7.2%	18.6M	17.6M	94.2%	16.5M	88.5%	1.1M	5.1M	24.1%	55.9%	42.0%	151bp	151bp	27%	26.8M	87.0%	1910.1Mb	20.1M	37.0%	74.8%	49.1%	141.0bp	74.1%	37.0%	109bp	137bp	36%	20.1M
RZZ075LA6	0.75	2.1M	1.3M	0.5M	0.2M	0.2M	0.90%	0.6M	2.1M	100.0%	0.0%	2.7%	2.1M	0.0bp	2.7M	2.7M	100.0%	8.9%	11.7M	11.3M	96.4%	10.6M	91.2%	0.6M	2.7M	20.2%	65.8%	38.0%	151bp	151bp	36%	14.1M	88.0%	1269.8Mb	12.8M	36.8%	90.7%	37.0%	141.0bp	78.2%	36.0%	112bp	141bp	36%	12.8M
RZZ076HA1	0.82	2.6M	1.5M	0.6M	0.2M	0.2M	0.94%	0.8M	2.6M	100.0%	0.0%	2.7%	2.6M	0.0bp	3.4M	3.4M	100.0%	9.6%	12.9M	12.4M	95.8%	11.5M	89.0%	0.9M	3.4M	22.2%	60.6%	37.0%	151bp	151bp	27%	15.9M	86.7%	1432.5Mb	14.3M	35.9%	90.1%	33.5%	141.0bp	75.9%	35.0%	115bp	141bp	36%	14.3M
RZZ076HA2	0.79	2.5M	1.5M	0.6M	0.2M	0.2M	0.89%	0.8M	2.5M	100.0%	0.0%	2.7%	2.5M	0.0bp	3.3M	3.3M	100.0%	9.3%	14.3M	13.8M	96.4%	12.9M	90.0%	0.9M	3.3M	20.3%	64.4%	37.0%	151bp	151bp	27%	17.4M	88.3%	1544.9Mb	15.8M	36.4%	90.9%	40.1%	141.0bp	78.8%	36.0%	111bp	137bp	36%	15.8M
RZZ076HA3	0.75	2.5M	1.4M	0.6M	0.2M	0.2M	0.92%	0.9M	2.5M	100.0%	0.0%	2.9%	2.5M	0.0bp	3.4M	3.4M	100.0%	9.6%	12.1M	11.6M	95.5%	10.6M	87.9%	0.9M	3.4M	23.0%	57.7%	38.0%	151bp	151bp	27%	15.5M	86.9%	1298.0Mb	13.4M	36.1%	86.3%	40.3%	141.0bp	74.9%	36.0%	111bp	137bp	36%	13.4M
RZZ076HA4	0.73	1.9M	1.1M	0.5M	0.1M	0.1M	0.89%	0.7M	1.9M	100.0%	0.0%	3.1%	1.9M	0.0bp	2.6M	2.6M	100.0%	8.5%	15.5M	14.9M	96.4%	13.8M	89.4%	1.1M	2.6M	14.2%	72.2%	38.0%	151bp	151bp	36%	19.3M	88.3%	1627.3Mb	16.9M	36.5%	88.0%	42.8%	141.0bp	84.3%	36.0%	109bp	137bp	36%	16.9M
RZZ076HA5	0.81	3.4M	2.0M	0.8M	0.3M	0.3M	0.91%	0.9M	3.4M	100.0%	0.0%	2.4%	3.4M	0.0bp	4.3M	4.3M	100.0%	9.3%	17.0M	16.3M	96.0%	15.4M	90.5%	0.9M	4.3M	22.6%	59.0%	38.0%	151bp	151bp	27%	21.4M	87.5%	1886.8Mb	18.7M	36.6%	87.6%	36.1%	141.0bp	76.7%	36.0%	115bp	141bp	36%	18.7M
RZZ076HA6	0.74	2.4M	1.4M	0.5M	0.2M	0.2M	0.88%	0.8M	2.4M	100.0%	0.0%	3.0%	2.4M	0.0bp	3.2M	3.2M	100.0%	9.9%	12.7M	12.2M	96.1%	11.2M	88.2%	1.0M	3.2M	20.9%	62.4%	37.0%	151bp	151bp	27%	15.9M	87.8%	1349.4Mb	14.1M	36.1%	88.7%	42.3%	141.0bp	77.4%	36.0%	109bp	137bp	36%	14.1M
RZZ076LA1	0.78	2.4M	1.3M	0.6M	0.2M	0.2M	0.95%	0.8M	2.4M	100.0%	0.0%	2.9%	2.4M	0.0bp	3.2M	3.2M	100.0%	8.8%	12.2M	11.6M	95.0%	10.7M	87.9%	0.9M	3.2M	22.0%	58.5%	39.0%	151bp	151bp	27%	16.1M	86.6%	1302.7Mb	13.4M	36.1%	82.8%	40.5%	141.0bp	75.8%	36.0%	113bp	141bp	36%	13.4M
RZZ076LA2	0.83	2.8M	1.6M	0.8M	0.2M	0.2M	0.89%	0.8M	2.8M	100.0%	0.0%	2.6%	2.8M	0.0bp	3.7M	3.7M	100.0%	8.7%	11.4M	11.0M	96.0%	10.0M	87.4%	1.0M	3.7M	27.2%	54.7%	38.0%	151bp	151bp	36%	14.2M	88.3%	1232.9Mb	12.5M	36.5%	88.3%	39.8%	141.0bp	71.6%	36.0%	112bp	141bp	36%	12.5M
RZZ076LA3	0.74	2.7M	1.6M	0.7M	0.2M	0.2M	0.92%	0.8M	2.7M	100.0%	0.0%	2.6%	2.7M	0.0bp	3.5M	3.5M	100.0%	9.4%	12.7M	12.2M	96.0%	11.2M	88.8%	0.9M	3.5M	23.5%	57.7%	37.0%	151bp	151bp	27%	15.9M	87.2%	1381.5Mb	14.0M	36.2%	87.9%	36.8%	141.0bp	74.9%	36.0%	113bp	141bp	36%	14.0M
RZZ076LA4	0.80	2.4M	1.4M	0.6M	0.2M	0.2M	0.90%	0.8M	2.4M	100.0%	0.0%	2.9%	2.4M	0.0bp	3.2M	3.2M	100.0%	8.0%	14.0M	13.5M	96.1%	12.4M	88.7%	1.0M	3.2M	19.2%	67.4%	37.0%	151bp	151bp	36%	16.8M	88.4%	1486.9Mb	15.2M	36.1%	90.7%	40.0%	141.0bp	79.1%	36.0%	111bp	137bp	36%	15.2M
RZZ076LA5	0.79	2.8M	1.4M	0.8M	0.2M	0.2M	0.96%	1.4M	2.8M	100.0%	0.0%	4.5%	2.8M	0.0bp	4.2M	4.2M	100.0%	7.5%	10.9M	9.8M	89.9%	8.7M	79.8%	1.1M	4.2M	29.3%	47.2%	48.0%	151bp	151bp	18%	20.6M	84.2%	918.4Mb	11.8M	37.4%	57.3%	67.4%	141.0bp	66.3%	37.0%	93bp	87bp	45%	11.8M
RZZ076LA6	0.85	3.0M	1.7M	0.8M	0.2M	0.2M	0.92%	1.0M	3.0M	100.0%	0.0%	2.9%	3.0M	0.0bp	4.1M	4.1M	100.0%	7.4%	15.9M	15.3M	95.7%	14.1M	88.5%	1.2M	4.1M	21.4%	62.5%	37.0%	151bp	151bp	27%	19.7M	88.2%	1668.2Mb	17.2M	36.0%	87.3%	42.3%	141.0bp	76.5%	35.0%	110bp	137bp	36%	17.2M
RZZ996HA1	0.79	2.5M	1.3M	0.7M	0.2M	0.2M	0.98%	1.0M	2.5M	100.0%	0.0%	3.3%	2.5M	0.0bp	3.5M	3.5M	100.0%	7.7%	10.3M	9.5M	92.4%	8.8M	84.9%	0.8M	3.5M	28.1%	51.7%	42.0%	151bp	151bp	27%	16.1M	86.4%	1051.6Mb	11.2M	35.7%	69.7%	50.2%	141.0bp	69.1%	35.0%	109bp	137bp	36%	11.2M
RZZ996HA2	0.88	2.9M	1.7M	0.8M	0.2M	0.2M	0.90%	0.7M	2.9M	100.0%	0.0%	2.1%	2.9M	0.0bp	3.7M	3.7M	100.0%	7.2%	12.7M	12.2M	96.6%	11.6M	91.4%	0.7M	3.7M	25.9%	59.0%	37.0%	151bp	151bp	36%	15.0M	89.0%	1369.1Mb	13.6M	36.7%	90.9%	38.4%	141.0bp	73.9%	36.0%	113bp	141bp	36%	13.6M
RZZ996HA3	0.86	2.2M	1.3M	0.6M	0.2M	0.2M	0.93%	0.8M	2.2M	100.0%	0.0%	3.0%	2.2M	0.0bp	3.0M	3.0M	100.0%	10.6%	11.1M	10.5M	95.3%	9.8M	88.7%	0.7M	3.0M	21.6%	58.9%	40.0%	151bp	151bp	27%	15.4M	86.8%	1169.4Mb	12.4M	36.4%	80.2%	45.1%	141.0bp	75.5%	36.0%	109bp	137bp	36%	12.4M
RZZ996HA4	0.79	2.5M	1.4M	0.7M	0.2M	0.2M	0.92%	0.9M	2.5M	100.0%	0.0%	3.1%	2.5M	0.0bp	3.3M	3.3M	100.0%	8.7%	14.4M	13.8M	95.6%	12.7M	88.1%	1.1M	3.3M	19.3%	65.6%	38.0%	151bp	151bp	36%	18.0M	87.8%	1530.4Mb	15.8M	36.5%	87.7%	41.3%	141.0bp	78.6%	36.0%	110bp	137bp	36%	15.8M
RZZ996HA5	0.85	2.8M	1.6M	0.7M	0.2M	0.2M	0.93%	0.8M	2.8M	100.0%	0.0%	2.4%	2.8M	0.0bp	3.5M	3.5M	100.0%	8.9%	16.2M	15.6M	96.2%	14.8M	91.1%	0.8M	3.5M	19.4%	64.5%	38.0%	151bp	151bp	27%	19.6M	87.4%	1821.9Mb	17.8M	36.8%	90.9%	32.6%	141.0bp	79.0%	36.0%	117bp	141bp	36%	17.8M
RZZ996HA6	0.99	2.6M	1.4M	0.7M	0.2M	0.2M	0.93%	1.1M	2.6M	100.0%	0.0%	3.5%	2.6M	0.0bp	3.7M	3.7M	100.0%	7.0%	14.0M	12.9M	91.9%	12.0M	85.2%	0.9M	3.7M	21.9%	60.5%	44.0%	151bp	151bp	27%	22.6M	87.3%	1364.8Mb	15.1M	36.3%	66.9%	55.8%	141.0bp	75.5%	36.0%	104bp	127bp	36%	15.1M
RZZ996LA1	0.92	2.6M	1.5M	0.7M	0.2M	0.2M	0.94%	0.8M	2.6M	100.0%	0.0%	2.8%	2.6M	0.0bp	3.4M	3.4M	100.0%	6.6%	14.2M	13.7M	95.8%	12.8M	89.7%	0.9M	3.4M	20.7%	62.1%	38.0%	151bp	151bp	27%	17.5M	87.8%	1516.0Mb	15.3M	36.8%	87.3%	39.5%	141.0bp	77.3%	36.0%	113bp	141bp	36%	15.3M
RZZ996LA2	0.73	2.3M	1.4M	0.6M	0.2M	0.2M	0.91%	0.8M	2.3M	100.0%	0.0%	2.8%	2.3M	0.0bp	3.1M	3.1M	100.0%	8.8%	13.7M	13.2M	96.2%	12.2M	89.0%	1.0M	3.1M	19.0%	67.7%	37.0%	151bp	151bp	36%	16.4M	88.0%	1484.2Mb	15.0M	36.4%	91.3%	36.9%	141.0bp	79.0%	36.0%	112bp	141bp	36%	15.0M
RZZ996LA3	0.62	2.6M	1.4M	0.7M	0.2M	0.2M	0.96%	0.9M	2.6M	100.0%	0.0%	2.8%	2.6M	0.0bp	3.5M	3.5M	100.0%	9.0%	12.5M	12.0M	95.5%	11.1M	88.6%	0.9M	3.5M	23.2%	58.4%	38.0%	151bp	151bp	27%	15.6M	87.0%	1336.3Mb	13.8M	36.1%	88.1%	39.8%	141.0bp	74.4%	36.0%	112bp	137bp	36%	13.8M
RZZ996LA4	0.78	3.2M	1.8M	0.9M	0.3M	0.2M	0.91%	1.1M	3.2M	100.0%	0.0%	3.0%	3.2M	0.0bp	4.4M	4.4M	100.0%	8.2%	14.7M	14.0M	95.1%	12.9M	87.5%	1.1M	4.4M	24.5%	57.0%	40.0%	151bp	151bp	27%	19.8M	87.2%	1505.0Mb	16.1M	36.5%	81.2%	45.7%	141.0bp	73.2%	36.0%	107bp	137bp	36%	16.1M
RZZ996LA5	0.86	2.5M	1.4M	0.7M	0.2M	0.2M	0.95%	0.8M	2.5M	100.0%	0.0%	2.9%	2.5M	0.0bp	3.3M	3.3M	100.0%	8.6%	14.4M	13.7M	95.5%	12.9M	89.4%	0.9M	3.3M	19.8%	62.0%	39.0%	151bp	151bp	27%	18.2M	87.5%	1559.2Mb	15.7M	37.2%	86.5%	39.5%	141.0bp	78.0%	37.0%	113bp	141bp	36%	15.7M
RZZ996LA6	0.71	2.1M	1.2M	0.6M	0.2M	0.1M	0.93%	0.9M	2.1M	100.0%	0.0%	3.6%	2.1M	0.0bp	3.0M	3.0M	100.0%	5.9%	18.7M	17.9M	95.6%	16.8M	89.8%	1.1M	3.0M	13.4%	73.3%	39.0%	151bp	151bp	27%	23.0M	88.5%	1899.8Mb	19.9M	37.0%	86.7%	45.6%	141.0bp	84.1%	37.0%	108bp	137bp	36%	19.9M
RZZ997HA1	0.83	2.8M	1.6M	0.7M	0.2M	0.2M	0.96%	1.0M	2.8M	100.0%	0.0%	3.0%	2.8M	0.0bp	3.7M	3.7M	100.0%	8.9%	16.0M	15.3M	95.5%	14.1M	88.4%	1.1M	3.7M	19.7%	64.2%	37.0%	151bp	151bp	27%	19.7M	87.3%	1737.4Mb	17.6M	35.7%	88.9%	37.4%	141.0bp	78.2%	35.0%	113bp	141bp	36%	17.6M
RZZ997HA2	0.87	2.9M	1.7M	0.7M	0.2M	0.2M	0.91%	0.8M	2.9M	100.0%	0.0%	2.5%	2.9M	0.0bp	3.7M	3.7M	100.0%	8.1%	14.2M	13.7M	96.4%	12.8M	90.3%	0.9M	3.7M	22.7%	63.1%	37.0%	151bp	151bp	36%	17.0M	88.3%	1523.7Mb	15.4M	36.1%	90.9%	37.9%	141.0bp	76.3%	36.0%	112bp	141bp	36%	15.4M
RZZ997HA3	0.70	2.9M	1.6M	0.7M	0.2M	0.2M	0.96%	1.0M	2.9M	100.0%	0.0%	2.8%	2.9M	0.0bp	3.8M	3.8M	100.0%	7.7%	15.8M	15.2M	96.0%	14.1M	88.9%	1.1M	3.8M	20.4%	62.2%	38.0%	151bp	151bp	36%	19.2M	87.3%	1697.1Mb	17.1M	36.4%	89.3%	37.3%	141.0bp	77.6%	36.0%	113bp	141bp	36%	17.1M
RZZ997HA4	0.80	3.0M	1.6M	0.8M	0.2M	0.2M	0.95%	1.1M	3.0M	100.0%	0.0%	3.1%	3.0M	0.0bp	4.0M	4.0M	100.0%	7.5%	18.7M	17.9M	95.6%	16.5M	88.3%	1.4M	4.0M	18.4%	66.0%	38.0%	151bp	151bp	27%	23.6M	87.6%	1954.5Mb	20.3M	36.0%	85.8%	42.4%	141.0bp	80.0%	36.0%	110bp	137bp	36%	20.3M
RZZ997HA5	0.65	3.9M	2.2M	1.0M	0.3M	0.3M	0.96%	1.3M	3.9M	100.0%	0.0%	2.9%	3.9M	0.0bp	5.2M	5.2M	100.0%	7.8%	18.6M	17.6M	94.7%	16.2M	87.1%	1.4M	5.2M	23.7%	55.8%	40.0%	151bp	151bp	27%	25.0M	86.8%	1970.6Mb	20.2M	36.4%	80.8%	42.7%	141.0bp	74.5%	36.0%	112bp	141bp	36%	20.2M
RZZ997HA6	0.72	2.3M	1.3M	0.6M	0.2M	0.2M	0.92%	0.8M	2.3M	100.0%	0.0%	2.9%	2.3M	0.0bp	3.0M	3.0M	100.0%	9.9%	12.5M	12.0M	96.2%	11.0M	88.1%	1.0M	3.0M	20.3%	64.4%	37.0%	151bp	151bp	36%	15.4M	87.8%	1344.3Mb	13.9M	35.9%	90.2%	39.6%	141.0bp	78.1%	35.0%	110bp	137bp	36%	13.9M
RZZ997LA1	0.79	2.4M	1.4M	0.6M	0.2M	0.2M	0.94%	0.7M	2.4M	100.0%	0.0%	2.7%	2.4M	0.0bp	3.1M	3.1M	100.0%	8.8%	14.0M	13.5M	96.2%	12.6M	90.0%	0.9M	3.1M	19.3%	64.5%	37.0%	151bp	151bp	36%	17.1M	87.7%	1538.2Mb	15.4M	36.5%	89.7%	36.3%	141.0bp	79.1%	36.0%	114bp	141bp	36%	15.4M
RZZ997LA2	0.82	3.3M	1.9M	0.9M	0.3M	0.3M	0.91%	0.8M	3.3M	100.0%	0.0%	2.0%	3.3M	0.0bp	4.1M	4.1M	100.0%	7.4%	16.2M	15.7M	96.6%	14.8M	91.1%	0.9M	4.1M	22.5%	63.2%	37.0%	151bp	151bp	36%	19.1M	89.0%	1791.5Mb	17.5M	36.7%	91.7%	35.6%	141.0bp	76.9%	36.0%	115bp	141bp	36%	17.5M
RZZ997LA3	0.79	2.3M	1.2M	0.7M	0.2M	0.2M	0.96%	0.8M	2.3M	100.0%	0.0%	3.0%	2.3M	0.0bp	3.1M	3.1M	100.0%	6.5%	12.0M	11.5M	95.5%	10.7M	88.5%	0.8M	3.1M	21.3%	60.2%	39.0%	151bp	151bp	36%	15.0M	87.7%	1252.5Mb	12.9M	36.8%	86.1%	42.3%	141.0bp	76.2%	36.0%	111bp	141bp	36%	12.9M
RZZ997LA4	0.88	2.8M	1.6M	0.7M	0.2M	0.2M	0.92%	0.9M	2.8M	100.0%	0.0%	2.8%	2.8M	0.0bp	3.7M	3.7M	100.0%	7.5%	14.1M	13.5M	95.8%	12.5M	88.9%	1.0M	3.7M	22.3%	61.8%	38.0%	151bp	151bp	36%	17.6M	88.2%	1487.4Mb	15.3M	36.3%	86.8%	41.5%	141.0bp	76.1%	36.0%	111bp	137bp	36%	15.3M
RZZ997LA5	0.84	2.7M	1.6M	0.7M	0.2M	0.2M	0.93%	0.8M	2.7M	100.0%	0.0%	2.7%	2.7M	0.0bp	3.6M	3.6M	100.0%	10.1%	15.3M	14.6M	95.8%	13.7M	90.0%	0.9M	3.6M	20.3%	63.4%	37.0%	151bp	151bp	27%	18.9M	87.3%	1710.3Mb	17.0M	36.2%	89.6%	34.3%	141.0bp	78.3%	36.0%	115bp	141bp	36%	17.0M
RZZ997LA6	1.00	2.0M	1.1M	0.6M	0.2M	0.1M	0.92%	0.6M	2.0M	100.0%	0.0%	2.5%	2.0M	0.0bp	2.6M	2.6M	100.0%	7.1%	7.7M	7.4M	96.2%	7.0M	89.8%	0.5M	2.6M	28.8%	54.5%	37.0%	151bp	151bp	36%	9.3M	88.6%	818.3Mb	8.3M	36.2%	89.3%	41.0%	141.0bp	69.9%	36.0%	111bp	137bp	36%	8.3M
RZZ999ZA1	0.78	2.6M	1.4M	0.7M	0.2M	0.2M	0.94%	0.9M	2.6M	100.0%	0.0%	3.2%	2.6M	0.0bp	3.5M	3.5M	100.0%	7.1%	12.7M	12.0M	94.5%	11.3M	88.4%	0.8M	3.5M	23.5%	57.7%	41.0%	151bp	151bp	36%	16.8M	87.1%	1339.1Mb	13.7M	36.8%	81.6%	43.0%	141.0bp	74.4%	36.0%	112bp	141bp	27%	13.7M
RZZ999ZA2	0.76	2.5M	1.5M	0.7M	0.2M	0.2M	0.90%	0.6M	2.5M	100.0%	0.0%	2.2%	2.5M	0.0bp	3.1M	3.1M	100.0%	8.2%	10.2M	9.9M	96.5%	9.3M	90.8%	0.6M	3.1M	27.2%	57.0%	38.0%	151bp	151bp	36%	12.2M	88.8%	1126.5Mb	11.1M	36.9%	91.2%	36.5%	141.0bp	72.4%	36.0%	114bp	141bp	36%	11.1M
RZZ999ZA3	0.71	2.2M	1.3M	0.6M	0.2M	0.2M	0.95%	0.8M	2.2M	100.0%	0.0%	3.1%	2.2M	0.0bp	3.0M	3.0M	100.0%	9.6%	14.2M	13.6M	95.5%	12.6M	88.4%	1.0M	3.0M	18.0%	66.0%	37.0%	151bp	151bp	27%	17.8M	87.2%	1558.1Mb	15.8M	36.0%	88.7%	36.8%	141.0bp	79.7%	35.0%	113bp	141bp	36%	15.8M
RZZ999ZA4	0.71	2.9M	1.6M	0.8M	0.2M	0.2M	0.93%	1.0M	2.9M	100.0%	0.0%	2.9%	2.9M	0.0bp	3.9M	3.9M	100.0%	7.8%	17.6M	16.9M	95.9%	15.7M	89.3%	1.2M	3.9M	19.2%	66.2%	38.0%	151bp	151bp	36%	21.6M	88.2%	1869.1Mb	19.1M	36.4%	88.2%	40.2%	141.0bp	79.3%	36.0%	111bp	141bp	36%	19.1M
RZZ999ZA5	0.77	3.4M	2.0M	0.9M	0.3M	0.3M	0.92%	0.9M	3.4M	100.0%	0.0%	2.4%	3.4M	0.0bp	4.3M	4.3M	100.0%	8.8%	18.1M	17.4M	95.9%	16.3M	89.7%	1.1M	4.3M	21.2%	61.5%	38.0%	151bp	151bp	27%	22.5M	87.8%	2038.3Mb	19.9M	37.1%	88.5%	34.1%	141.0bp	77.8%	37.0%	117bp	141bp	36%	19.9M
RZZ999ZA6	0.87	3.1M	1.7M	0.8M	0.2M	0.2M	0.93%	1.1M	3.1M	100.0%	0.0%	3.1%	3.1M	0.0bp	4.2M	4.2M	100.0%	7.3%	18.5M	17.7M	95.7%	16.4M	88.4%	1.4M	4.2M	18.9%	66.8%	38.0%	151bp	151bp	36%	22.5M	87.9%	1940.4Mb	20.0M	36.2%	88.6%	40.7%	141.0bp	79.3%	36.0%	111bp	137bp	36%	20.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	QualiMap: RNASeq	5'-3' bias	5'-3' bias	`qualimap_rnaseq-5_3_bias`
\|\|	QualiMap: RNASeq	M Aligned	Reads Aligned (millions)	`qualimap_rnaseq-reads_aligned`	read_count
\|\|	QualiMap: RNASeq	Exonic	Reads aligned to exonic regions	`qualimap_rnaseq-reads_aligned_exonic`	read_count
\|\|	QualiMap: RNASeq	Intronic	Reads aligned to intronic regions	`qualimap_rnaseq-reads_aligned_intronic`	read_count
\|\|	QualiMap: RNASeq	Intergenic	Reads aligned to intergenic regions	`qualimap_rnaseq-reads_aligned_intergenic`	read_count
\|\|	QualiMap: RNASeq	Overlapping Exon	Reads aligned to overlapping exon regions	`qualimap_rnaseq-reads_aligned_overlapping_exon`	read_count
\|\|	Samtools: stats	Error rate	Error rate: mismatches (NM) / bases mapped (CIGAR)	`samtools_stats-error_rate`
\|\|	Samtools: stats	Non-primary	Non-primary alignments (millions)	`samtools_stats-non_primary_alignments`	read_count
\|\|	Samtools: stats	Reads mapped	Reads mapped in the bam file (millions)	`samtools_stats-reads_mapped`	read_count
\|\|	Samtools: stats	% Mapped	% Mapped reads	`samtools_stats-reads_mapped_percent`
\|\|	Samtools: stats	% Proper pairs	% Properly paired reads	`samtools_stats-reads_properly_paired_percent`
\|\|	Samtools: stats	% MapQ 0 reads	% of reads that are ambiguously placed (MapQ=0)	`samtools_stats-reads_MQ0_percent`
\|\|	Samtools: stats	Total seqs	Total sequences in the bam file (millions)	`samtools_stats-raw_total_sequences`	read_count
\|\|	Samtools: stats	Mean insert	Average insert size	`samtools_stats-insert_size_average`
\|\|	Samtools: flagstat	Reads	Total reads in the bam file (millions)	`samtools_flagstat-flagstat_total`	read_count
\|\|	Samtools: flagstat	Reads mapped	Reads mapped in the bam file (millions)	`samtools_flagstat-mapped_passed`	read_count
\|\|	Samtools: flagstat	% Reads mapped	% Reads mapped in the bam file	`samtools_flagstat-mapped_passed_pct`
\|\|	SortMeRNA	rRNA	Percentage of reads matched to a SortMeRNA database	`sortmerna-rRNA_pct`
\|\|	STAR	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	STAR	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	STAR	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	STAR	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	STAR	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	STAR	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	UMI-tools	M Unique Reads	Reads remaining after deduplication (millions)	`umi_tools-dedup_output_reads`	read_count
\|\|	UMI-tools	% Pass Dedup	% processed reads that passed deduplication	`umi_tools-dedup_percent_passing`
\|\|	FastQC (raw)	Dups	% duplicate reads	`fastqc_raw-percent_duplicates`
\|\|	FastQC (raw)	GC	Average % GC content	`fastqc_raw-percent_gc`
\|\|	FastQC (raw)	Avg len	Average read length	`fastqc_raw-avg_sequence_length`
\|\|	FastQC (raw)	Median len	Median read length	`fastqc_raw-median_sequence_length`
\|\|	FastQC (raw)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_raw-percent_fails`
\|\|	FastQC (raw)	Seqs	Total sequences (millions)	`fastqc_raw-total_sequences`	read_count
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`fastp-after_filtering_q30_rate`
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`fastp-after_filtering_q30_bases`	base_count
\|\|	fastp	Reads After Filtering	Total reads after filtering (millions)	`fastp-filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`fastp-after_filtering_gc_content`
\|\|	fastp	% PF	Percent reads passing filter	`fastp-pct_surviving`
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`fastp-pct_adapter`
\|\|	fastp	Mean R1 Length	Mean read length of R1	`fastp-before_filtering_read1_mean_length`
\|\|	FastQC (trimmed)	Dups	% duplicate reads	`fastqc_trimmed-percent_duplicates`
\|\|	FastQC (trimmed)	GC	Average % GC content	`fastqc_trimmed-percent_gc`
\|\|	FastQC (trimmed)	Avg len	Average read length	`fastqc_trimmed-avg_sequence_length`
\|\|	FastQC (trimmed)	Median len	Median read length	`fastqc_trimmed-median_sequence_length`
\|\|	FastQC (trimmed)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_trimmed-percent_fails`
\|\|	FastQC (trimmed)	Seqs	Total sequences (millions)	`fastqc_trimmed-total_sequences`	read_count

Sample status checks

Reports on sample strandedness status, and any failures in trimming or mapping.

Strandedness Checks

The strandedness used for analysis in this workflow can either be provided by the user or automatically inferred by Salmon using a sample of reads. In both cases, strandedness is verified at the end of the workflow using RSeQC's infer_experiment.py on genomic alignments. In this table, a pass indicates a match between the supplied strandedness (or that inferred by Salmon) and RSeQC results. A fail indicates a mismatch or 'undetermined' strandedness. 'Undetermined' strandedness can signal QC issues, including potential genomic DNA contamination.

Note: Rows are duplicated for an 'auto' setting to allow comparison of statistics between inference methods.

Showing ¹⁹²/₁₉₂ rows and ⁷/₇ columns.

Sample	Status	Strand inference method	Provided strandedness	Inferred strandedness	Sense (%)	Antisense (%)	Unstranded (%)
RZY000ZA1	pass	RSeQC	auto	forward	84.6	2.9	12.6
RZY000ZA2	pass	RSeQC	auto	forward	86.7	3.0	10.3
RZY000ZA3	pass	RSeQC	auto	forward	86.2	3.1	10.7
RZY000ZA4	pass	RSeQC	auto	forward	87.3	3.1	9.7
RZY000ZA5	pass	RSeQC	auto	forward	87.7	2.6	9.7
RZY000ZA6	pass	RSeQC	auto	forward	85.5	3.1	11.4
RZY019HA1	pass	RSeQC	auto	forward	87.8	2.9	9.3
RZY019HA2	pass	RSeQC	auto	forward	87.8	2.9	9.2
RZY019HA3	pass	RSeQC	auto	forward	88.4	2.8	8.8
RZY019HA4	pass	RSeQC	auto	forward	87.1	2.7	10.2
RZY019HA5	pass	RSeQC	auto	forward	87.8	2.9	9.3
RZY019HA6	pass	RSeQC	auto	forward	88.3	3.0	8.8
RZY019LA1	pass	RSeQC	auto	forward	85.3	3.5	11.2
RZY019LA2	pass	RSeQC	auto	forward	87.2	3.0	9.8
RZY019LA3	pass	RSeQC	auto	forward	87.9	3.1	9.0
RZY019LA4	pass	RSeQC	auto	forward	88.4	3.2	8.4
RZY019LA5	pass	RSeQC	auto	forward	88.1	2.7	9.2
RZY019LA6	pass	RSeQC	auto	forward	88.5	2.7	8.9
RZY996LA1	pass	RSeQC	auto	forward	87.3	2.8	9.9
RZY996LA2	pass	RSeQC	auto	forward	85.5	3.3	11.3
RZY996LA3	pass	RSeQC	auto	forward	87.4	3.2	9.4
RZY996LA4	pass	RSeQC	auto	forward	86.2	3.5	10.4
RZY996LA5	pass	RSeQC	auto	forward	87.8	2.9	9.4
RZY996LA6	pass	RSeQC	auto	forward	88.3	3.1	8.6
RZY996MA1	pass	RSeQC	auto	forward	85.9	4.0	10.1
RZY996MA2	pass	RSeQC	auto	forward	88.3	2.7	9.0
RZY996MA3	pass	RSeQC	auto	forward	86.2	3.3	10.5
RZY996MA4	pass	RSeQC	auto	forward	87.9	2.8	9.3
RZY996MA5	pass	RSeQC	auto	forward	85.7	3.3	11.0
RZY996MA6	pass	RSeQC	auto	forward	86.5	3.4	10.1
RZY999ZA1	pass	RSeQC	auto	forward	86.3	3.5	10.2
RZY999ZA2	pass	RSeQC	auto	forward	86.6	2.9	10.4
RZY999ZA3	pass	RSeQC	auto	forward	88.2	2.7	9.1
RZY999ZA4	pass	RSeQC	auto	forward	86.0	3.4	10.5
RZY999ZA5	pass	RSeQC	auto	forward	86.3	3.2	10.5
RZY999ZA6	pass	RSeQC	auto	forward	85.5	3.0	11.5
RZZ000ZA1	pass	RSeQC	auto	forward	88.1	2.2	9.7
RZZ000ZA2	pass	RSeQC	auto	forward	86.5	2.3	11.2
RZZ000ZA3	pass	RSeQC	auto	forward	87.3	2.2	10.5
RZZ000ZA4	pass	RSeQC	auto	forward	86.9	2.5	10.6
RZZ000ZA5	pass	RSeQC	auto	forward	87.3	2.4	10.3
RZZ000ZA6	pass	RSeQC	auto	forward	88.2	2.7	9.1
RZZ014HA1	pass	RSeQC	auto	forward	88.5	2.4	9.0
RZZ014HA2	pass	RSeQC	auto	forward	88.2	2.4	9.4
RZZ014HA3	pass	RSeQC	auto	forward	86.6	2.7	10.8
RZZ014HA4	pass	RSeQC	auto	forward	86.5	2.3	11.1
RZZ014HA5	pass	RSeQC	auto	forward	87.9	2.6	9.5
RZZ014HA6	pass	RSeQC	auto	forward	86.1	2.5	11.3
RZZ014LA1	pass	RSeQC	auto	forward	87.0	2.4	10.6
RZZ014LA2	pass	RSeQC	auto	forward	87.7	2.4	9.9
RZZ014LA3	pass	RSeQC	auto	forward	87.5	2.4	10.2
RZZ014LA4	pass	RSeQC	auto	forward	87.7	2.5	9.9
RZZ014LA5	pass	RSeQC	auto	forward	85.9	2.2	11.9
RZZ014LA6	pass	RSeQC	auto	forward	87.6	2.0	10.5
RZZ015HA1	pass	RSeQC	auto	forward	86.9	2.6	10.4
RZZ015HA2	pass	RSeQC	auto	forward	87.9	2.4	9.7
RZZ015HA3	pass	RSeQC	auto	forward	85.5	2.4	12.0
RZZ015HA4	pass	RSeQC	auto	forward	87.8	2.5	9.7
RZZ015HA5	pass	RSeQC	auto	forward	86.8	2.4	10.8
RZZ015HA6	pass	RSeQC	auto	forward	87.9	3.1	9.1
RZZ015LA1	pass	RSeQC	auto	forward	86.7	2.5	10.8
RZZ015LA2	pass	RSeQC	auto	forward	86.5	2.3	11.2
RZZ015LA3	pass	RSeQC	auto	forward	88.3	2.2	9.4
RZZ015LA4	pass	RSeQC	auto	forward	87.7	2.6	9.7
RZZ015LA5	pass	RSeQC	auto	forward	86.2	2.8	11.1
RZZ015LA6	pass	RSeQC	auto	forward	87.0	2.4	10.5
RZZ016HA1	pass	RSeQC	auto	forward	87.5	2.7	9.8
RZZ016HA2	pass	RSeQC	auto	forward	87.1	2.9	10.0
RZZ016HA3	pass	RSeQC	auto	forward	87.3	3.0	9.7
RZZ016HA4	pass	RSeQC	auto	forward	87.3	3.3	9.4
RZZ016HA5	pass	RSeQC	auto	forward	85.9	3.5	10.7
RZZ016HA6	pass	RSeQC	auto	forward	85.1	3.8	11.2
RZZ016LA1	pass	RSeQC	auto	forward	87.1	2.9	10.0
RZZ016LA2	pass	RSeQC	auto	forward	86.8	2.3	10.9
RZZ016LA3	pass	RSeQC	auto	forward	86.6	2.3	11.1
RZZ016LA4	pass	RSeQC	auto	forward	86.0	2.3	11.7
RZZ016LA5	pass	RSeQC	auto	forward	87.6	2.4	10.1
RZZ016LA6	pass	RSeQC	auto	forward	86.6	2.2	11.2
RZZ017HA1	pass	RSeQC	auto	forward	88.1	2.7	9.2
RZZ017HA2	pass	RSeQC	auto	forward	87.1	2.9	10.0
RZZ017HA3	pass	RSeQC	auto	forward	87.9	2.6	9.5
RZZ017HA4	pass	RSeQC	auto	forward	86.4	2.9	10.7
RZZ017HA5	pass	RSeQC	auto	forward	88.3	2.4	9.4
RZZ017HA6	pass	RSeQC	auto	forward	85.8	2.9	11.3
RZZ017LA1	pass	RSeQC	auto	forward	87.6	2.5	9.9
RZZ017LA2	pass	RSeQC	auto	forward	87.2	2.2	10.6
RZZ017LA3	pass	RSeQC	auto	forward	87.2	2.3	10.5
RZZ017LA4	pass	RSeQC	auto	forward	87.8	2.5	9.7
RZZ017LA5	pass	RSeQC	auto	forward	87.1	2.2	10.8
RZZ017LA6	pass	RSeQC	auto	forward	89.0	2.1	9.0
RZZ018HA1	pass	RSeQC	auto	forward	86.9	2.7	10.4
RZZ018HA2	pass	RSeQC	auto	forward	87.2	2.5	10.2
RZZ018HA3	pass	RSeQC	auto	forward	86.5	2.6	10.9
RZZ018HA4	pass	RSeQC	auto	forward	86.9	2.6	10.5
RZZ018HA5	pass	RSeQC	auto	forward	86.4	2.5	11.1
RZZ018HA6	pass	RSeQC	auto	forward	87.0	2.6	10.5
RZZ018LA1	pass	RSeQC	auto	forward	88.3	2.3	9.5
RZZ018LA2	pass	RSeQC	auto	forward	86.4	2.7	10.9
RZZ018LA3	pass	RSeQC	auto	forward	85.3	2.4	12.2
RZZ018LA4	pass	RSeQC	auto	forward	87.5	2.6	9.9
RZZ018LA5	pass	RSeQC	auto	forward	87.2	2.2	10.7
RZZ018LA6	pass	RSeQC	auto	forward	87.2	2.3	10.5
RZZ019HA1	pass	RSeQC	auto	forward	87.4	2.4	10.2
RZZ019HA2	pass	RSeQC	auto	forward	88.0	2.2	9.8
RZZ019HA3	pass	RSeQC	auto	forward	86.4	2.6	11.0
RZZ019HA4	pass	RSeQC	auto	forward	88.1	2.4	9.5
RZZ019HA5	pass	RSeQC	auto	forward	85.1	2.4	12.6
RZZ019HA6	pass	RSeQC	auto	forward	86.9	2.4	10.7
RZZ019LA1	pass	RSeQC	auto	forward	87.4	2.8	9.8
RZZ019LA2	pass	RSeQC	auto	forward	89.0	2.2	8.8
RZZ019LA3	pass	RSeQC	auto	forward	86.9	2.3	10.8
RZZ019LA4	pass	RSeQC	auto	forward	86.6	2.5	10.9
RZZ019LA5	pass	RSeQC	auto	forward	86.2	2.3	11.6
RZZ019LA6	pass	RSeQC	auto	forward	87.6	2.3	10.1
RZZ035HA1	pass	RSeQC	auto	forward	87.6	2.6	9.8
RZZ035HA2	pass	RSeQC	auto	forward	86.6	2.2	11.2
RZZ035HA3	pass	RSeQC	auto	forward	86.9	2.4	10.7
RZZ035HA4	pass	RSeQC	auto	forward	87.1	3.2	9.7
RZZ035HA5	pass	RSeQC	auto	forward	87.3	2.4	10.3
RZZ035HA6	pass	RSeQC	auto	forward	87.3	2.2	10.4
RZZ035LA1	pass	RSeQC	auto	forward	87.5	2.4	10.1
RZZ035LA2	pass	RSeQC	auto	forward	88.5	2.2	9.3
RZZ035LA3	pass	RSeQC	auto	forward	87.6	2.4	10.1
RZZ035LA4	pass	RSeQC	auto	forward	87.7	2.6	9.7
RZZ035LA5	pass	RSeQC	auto	forward	87.8	2.7	9.5
RZZ035LA6	pass	RSeQC	auto	forward	87.6	2.3	10.0
RZZ074HA1	pass	RSeQC	auto	forward	86.7	2.4	10.9
RZZ074HA2	pass	RSeQC	auto	forward	86.2	3.0	10.8
RZZ074HA3	pass	RSeQC	auto	forward	85.4	3.2	11.4
RZZ074HA4	pass	RSeQC	auto	forward	87.3	2.9	9.8
RZZ074HA5	pass	RSeQC	auto	forward	85.7	2.6	11.8
RZZ074HA6	pass	RSeQC	auto	forward	86.5	2.7	10.7
RZZ074LA1	pass	RSeQC	auto	forward	88.2	2.5	9.3
RZZ074LA2	pass	RSeQC	auto	forward	88.2	2.2	9.6
RZZ074LA3	pass	RSeQC	auto	forward	85.9	2.3	11.8
RZZ074LA4	pass	RSeQC	auto	forward	87.4	2.5	10.1
RZZ074LA5	pass	RSeQC	auto	forward	88.2	2.5	9.3
RZZ074LA6	pass	RSeQC	auto	forward	88.6	1.5	9.9
RZZ075HA1	pass	RSeQC	auto	forward	86.0	2.6	11.4
RZZ075HA2	pass	RSeQC	auto	forward	87.6	2.2	10.3
RZZ075HA3	pass	RSeQC	auto	forward	84.6	2.7	12.6
RZZ075HA4	pass	RSeQC	auto	forward	88.3	2.7	9.0
RZZ075HA5	pass	RSeQC	auto	forward	87.7	2.5	9.9
RZZ075HA6	pass	RSeQC	auto	forward	86.3	2.6	11.1
RZZ075LA1	pass	RSeQC	auto	forward	86.4	2.8	10.7
RZZ075LA2	pass	RSeQC	auto	forward	88.5	2.1	9.4
RZZ075LA3	pass	RSeQC	auto	forward	86.6	2.3	11.1
RZZ075LA4	pass	RSeQC	auto	forward	87.2	2.3	10.5
RZZ075LA5	pass	RSeQC	auto	forward	87.6	2.6	9.8
RZZ075LA6	pass	RSeQC	auto	forward	88.0	2.1	9.9
RZZ076HA1	pass	RSeQC	auto	forward	86.6	2.5	10.9
RZZ076HA2	pass	RSeQC	auto	forward	87.1	2.7	10.2
RZZ076HA3	pass	RSeQC	auto	forward	86.8	2.6	10.5
RZZ076HA4	pass	RSeQC	auto	forward	84.9	3.0	12.1
RZZ076HA5	pass	RSeQC	auto	forward	84.5	2.6	12.9
RZZ076HA6	pass	RSeQC	auto	forward	86.8	2.9	10.3
RZZ076LA1	pass	RSeQC	auto	forward	87.8	2.5	9.7
RZZ076LA2	pass	RSeQC	auto	forward	86.8	2.2	11.0
RZZ076LA3	pass	RSeQC	auto	forward	86.4	2.4	11.2
RZZ076LA4	pass	RSeQC	auto	forward	87.3	2.3	10.4
RZZ076LA5	pass	RSeQC	auto	forward	87.0	3.4	9.5
RZZ076LA6	pass	RSeQC	auto	forward	86.1	2.4	11.5
RZZ996HA1	pass	RSeQC	auto	forward	87.5	2.9	9.7
RZZ996HA2	pass	RSeQC	auto	forward	86.8	2.3	10.9
RZZ996HA3	pass	RSeQC	auto	forward	88.1	2.3	9.7
RZZ996HA4	pass	RSeQC	auto	forward	87.6	2.4	9.9
RZZ996HA5	pass	RSeQC	auto	forward	87.0	2.1	10.9
RZZ996HA6	pass	RSeQC	auto	forward	86.9	2.9	10.2
RZZ996LA1	pass	RSeQC	auto	forward	87.3	2.5	10.2
RZZ996LA2	pass	RSeQC	auto	forward	87.8	2.3	9.9
RZZ996LA3	pass	RSeQC	auto	forward	87.3	2.5	10.3
RZZ996LA4	pass	RSeQC	auto	forward	86.1	2.5	11.4
RZZ996LA5	pass	RSeQC	auto	forward	88.1	2.5	9.5
RZZ996LA6	pass	RSeQC	auto	forward	88.4	2.6	9.0
RZZ997HA1	pass	RSeQC	auto	forward	85.9	2.7	11.4
RZZ997HA2	pass	RSeQC	auto	forward	85.6	2.4	12.0
RZZ997HA3	pass	RSeQC	auto	forward	85.9	2.7	11.4
RZZ997HA4	pass	RSeQC	auto	forward	85.5	2.9	11.7
RZZ997HA5	pass	RSeQC	auto	forward	85.4	3.0	11.6
RZZ997HA6	pass	RSeQC	auto	forward	87.3	2.3	10.4
RZZ997LA1	pass	RSeQC	auto	forward	88.1	2.4	9.6
RZZ997LA2	pass	RSeQC	auto	forward	86.2	2.2	11.7
RZZ997LA3	pass	RSeQC	auto	forward	88.2	2.6	9.2
RZZ997LA4	pass	RSeQC	auto	forward	86.9	2.3	10.8
RZZ997LA5	pass	RSeQC	auto	forward	87.1	2.3	10.6
RZZ997LA6	pass	RSeQC	auto	forward	88.8	2.3	8.9
RZZ999ZA1	pass	RSeQC	auto	forward	87.4	2.6	10.0
RZZ999ZA2	pass	RSeQC	auto	forward	87.7	2.1	10.2
RZZ999ZA3	pass	RSeQC	auto	forward	87.7	2.6	9.7
RZZ999ZA4	pass	RSeQC	auto	forward	87.1	2.3	10.6
RZZ999ZA5	pass	RSeQC	auto	forward	85.8	2.3	12.0
RZZ999ZA6	pass	RSeQC	auto	forward	86.3	2.5	11.1

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fail_strand_check_table_table

Sort	Column	Description	ID
\|\|	Status	Pass if the strandedness inferred by RSeQC matches that provided by the user or predicted by Salmon. Fail otherwise.	`samples_strandedness_check-Status`
\|\|	Strand inference method	Tool used to detect strandedness	`samples_strandedness_check-Strand_inference_method`
\|\|	Provided strandedness	User-provided strandedness	`samples_strandedness_check-Provided_strandedness`
\|\|	Inferred strandedness	Interred strandedness	`samples_strandedness_check-Inferred_strandedness`
\|\|	Sense (%)	Sense (%)	`samples_strandedness_check-Sense`
\|\|	Antisense (%)	Antisense (%)	`samples_strandedness_check-Antisense`
\|\|	Unstranded (%)	Unstranded (%)	`samples_strandedness_check-Unstranded`

FastQC (raw)

This section of the report shows FastQC results before adapter trimming.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

192

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

192

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

21

91

80

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

192

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

192

All samples have sequences of a single length (151bp)

Sequence Duplication Levels

4

188

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

192 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁵/₅ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
ATAACCTATAATCAACCTAAAACCACAAACTAAACCATTATATTATCCTA	125	2934085	0.0849%
GGGGGGTGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	36	926450	0.0268%
GGGAGATGAATAAAAGTTCAGCTTCGTACACCCCAAATTAAAAAATTAAA	11	207596	0.0060%
AGTTTCTATCTGTAAAGCTATTTTTTCCTAGTACGAAAGGATCGGAAAAA	9	167303	0.0048%
CGGAAGAGCACACGTCTGAACTCCAGTCACAGTTATGTGCAGATCTCGTA	1	30954	0.0009%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_raw_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_raw-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_raw-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_raw-total_percent`

Adapter Content

192

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Created with MultiQC

fastp

All-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).https://github.com/OpenGene/fastpDOI: 10.1093/bioinformatics/bty560

Fastp goes through fastq files in a folder and perform a series of quality control and filtering. Quality control and reporting are displayed both before and after filtering, allowing for a clear depiction of the consequences of the filtering process. Notably, the latter can be conducted on a variety of parameters including quality scores, length, as well as the presence of adapters, polyG, or polyX tailing.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (trimmed)

This section of the report shows FastQC results after adapter trimming.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

192

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

192

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

192

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

192

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

192

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

192

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
GCTGGTTGTCTGGGAGATGAATAAAAGTTCAGCTTCGTACACCCCAAATT	192	36350169	1.2802%
ATCAACCTAAAACCACAAACTAAACCATTATATTATCCTAGTATGGGAGA	192	27843800	0.9806%
ATCAACCTAAAACCACAAACTAAACCATTATATTATCCTAGTATGGG	192	15188885	0.5349%
TCTGTAAAGCTATTTTTTCCTAGTACGAAAGGATCGGAAAAAGGGGGCCC	192	8057750	0.2838%
TGTAAAGCTATTTTTTCCTAGTACGAAAGGATCGGAAAAAGGGGGCCCAT	191	7527033	0.2651%
GTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCAGTTTCTATC	192	6709004	0.2363%
GCTAGCTTAACCATCAAGATCAACTTAAAAACATCAATAACCTATAATCA	192	6474022	0.2280%
AACATCAATAACCTATAATCAACCTAAAACCACAAACTAAACCATTATAT	191	6210383	0.2187%
ACCTATAATCAACCTAAAACCACAAACTAAACCATTATATTATCCTAGTA	188	5025607	0.1770%
ATCAACCTAAAACCACAAACTAAACCATTATATTATCCTAGTATGGGAG	184	4759155	0.1676%
TTATCCTAGTATGGGAGACAGAAAAGATAAAATACTAAGCAATAGAGAAA	175	4711921	0.1659%
CCATCAAGATCAACTTAAAAACATCAATAACCTATAATCAACCTAAAACC	191	4654013	0.1639%
GAGTGGGAAGAGCTCCGGGTAGAAGTGACAGACCTATCGAACCTGGCAAT	171	4318167	0.1521%
AGTGACAGACCTATCGAACCTGGCAATAGCTGGTTGTCTGGGAGATGAAT	168	3609803	0.1271%
AAACATCAATAACCTATAATCAACCTAAAACCACAAACTAAACCATTATA	151	2658753	0.0936%
ACCATCAAGATCAACTTAAAAACATCAATAACCTATAATCAACCTAAAAC	155	2653301	0.0934%
GCTTAACCATCAAGATCAACTTAAAAACATCAATAACCTATAATCAACCT	110	1938045	0.0683%
CGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTAAG	84	1919569	0.0676%
AGGAAAGACTAAAAGAAAGGGAAGGAACTCGGCAAACACAAGCCTCGCCT	74	1640009	0.0578%
GGGAGATGAATAAAAGTTCAGCTTCGTACACCCCAAATTAAAAAATTAAA	59	1011539	0.0356%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_trimmed_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_trimmed-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_trimmed-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_trimmed-total_percent`

Adapter Content

1

191

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Created with MultiQC

Preseq

Estimates library complexity, showing how many additional unique reads are sequenced for increasing total read count.http://smithlabresearch.org/software/preseqDOI: 10.1038/nmeth.2375

A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

QualiMap

Quality control of alignment data and its derivatives like feature counts.http://qualimap.bioinfo.cipf.esDOI: 10.1093/bioinformatics/btv566; 10.1093/bioinformatics/bts503

Genomic origin of reads

Classification of mapped reads as originating in exonic, intronic or intergenic regions. These can be displayed as either the number or percentage of mapped reads.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. This allows mapped reads to be grouped by whether they originate in an exonic region (for QualiMap, this may include 5′ and 3′ UTR regions as well as protein-coding exons), an intron, or an intergenic region (see the Qualimap 2 documentation).

The inferred genomic origins of RNA-seq reads are presented here as a bar graph showing either the number or percentage of mapped reads in each read dataset that have been assigned to each type of genomic region. This graph can be used to assess the proportion of useful reads in an RNA-seq experiment. That proportion can be reduced by the presence of intron sequences, especially if depletion of ribosomal RNA was used during sample preparation (Sims et al. 2014). It can also be reduced by off-target transcripts, which are detected in greater numbers at the sequencing depths needed to detect poorly-expressed transcripts (Tarazona et al. 2011).

Created with MultiQC

Gene Coverage Profile

Mean distribution of coverage depth across the length of all mapped transcripts.

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. QualiMap uses this information to calculate the depth of coverage along the length of each annotated transcript. For a set of reads mapped to a transcript, the depth of coverage at a given base position is the number of high-quality reads that map to the transcript at that position (Sims et al. 2014).

QualiMap calculates coverage depth at every base position of each annotated transcript. To enable meaningful comparison between transcripts, base positions are rescaled to relative positions expressed as percentage distance along each transcript (0%, 1%, …, 99%). For the set of transcripts with at least one mapped read, QualiMap plots the cumulative mapped-read depth (y-axis) at each relative transcript position (x-axis). This plot shows the gene coverage profile across all mapped transcripts for each read dataset. It provides a visual way to assess positional biases, such as an accumulation of mapped reads at the 3′ end of transcripts, which may indicate poor RNA quality in the original sample (Conesa et al. 2016).

The Normalised plot is calculated by MultiQC to enable comparison of samples with varying sequencing depth. The cumulative mapped-read depth at each position across the averaged transcript position are divided by the total for that sample across the entire averaged transcript.

Created with MultiQC

RSeQC

Evaluates high throughput RNA-seq data.http://rseqc.sourceforge.netDOI: 10.1093/bioinformatics/bts356

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹⁰/₁₀ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	+ve strand	-ve strand	Non-splice reads	Splice reads
RZY000ZA1	2.9M	0.0M	0.0M	0.9M	0.0M	1.8M	1.0M	0.8M	1.6M	0.2M
RZY000ZA2	2.5M	0.0M	0.0M	0.8M	0.0M	1.5M	0.8M	0.7M	1.3M	0.2M
RZY000ZA3	2.5M	0.0M	0.0M	0.8M	0.0M	1.5M	0.8M	0.7M	1.3M	0.2M
RZY000ZA4	3.2M	0.0M	0.0M	1.0M	0.0M	2.0M	1.0M	0.9M	1.8M	0.2M
RZY000ZA5	3.1M	0.0M	0.0M	0.8M	0.0M	2.0M	1.1M	1.0M	1.8M	0.2M
RZY000ZA6	2.7M	0.0M	0.0M	0.9M	0.0M	1.6M	0.9M	0.8M	1.4M	0.2M
RZY019HA1	3.1M	0.0M	0.0M	0.9M	0.0M	2.0M	1.0M	0.9M	1.8M	0.2M
RZY019HA2	2.8M	0.0M	0.0M	0.8M	0.0M	1.8M	1.0M	0.9M	1.6M	0.2M
RZY019HA3	2.9M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY019HA4	3.7M	0.0M	0.0M	1.0M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZY019HA5	3.0M	0.0M	0.0M	0.8M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY019HA6	3.0M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY019LA1	2.2M	0.0M	0.0M	0.7M	0.0M	1.3M	0.7M	0.6M	1.2M	0.2M
RZY019LA2	3.6M	0.0M	0.0M	1.1M	0.0M	2.2M	1.2M	1.0M	2.0M	0.2M
RZY019LA3	3.4M	0.0M	0.0M	1.0M	0.0M	2.1M	1.1M	1.0M	1.9M	0.2M
RZY019LA4	3.1M	0.0M	0.0M	1.0M	0.0M	1.8M	1.0M	0.9M	1.7M	0.2M
RZY019LA5	3.1M	0.0M	0.0M	0.9M	0.0M	2.0M	1.0M	0.9M	1.7M	0.2M
RZY019LA6	3.0M	0.0M	0.0M	0.8M	0.0M	2.0M	1.0M	0.9M	1.7M	0.3M
RZY996LA1	3.4M	0.0M	0.0M	1.1M	0.0M	2.0M	1.1M	1.0M	1.8M	0.2M
RZY996LA2	2.2M	0.0M	0.0M	0.7M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
RZY996LA3	2.9M	0.0M	0.0M	0.9M	0.0M	1.8M	1.0M	0.8M	1.6M	0.2M
RZY996LA4	2.8M	0.0M	0.0M	0.9M	0.0M	1.6M	0.9M	0.8M	1.5M	0.2M
RZY996LA5	3.0M	0.0M	0.0M	0.8M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY996LA6	3.0M	0.0M	0.0M	0.9M	0.0M	1.8M	1.0M	0.9M	1.6M	0.2M
RZY996MA1	2.3M	0.0M	0.0M	0.8M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
RZY996MA2	3.0M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY996MA3	2.8M	0.0M	0.0M	0.8M	0.0M	1.8M	0.9M	0.8M	1.6M	0.2M
RZY996MA4	3.0M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY996MA5	2.7M	0.0M	0.0M	0.8M	0.0M	1.7M	0.9M	0.8M	1.5M	0.2M
RZY996MA6	2.6M	0.0M	0.0M	0.8M	0.0M	1.6M	0.9M	0.7M	1.4M	0.2M
RZY999ZA1	3.7M	0.0M	0.0M	1.3M	0.0M	2.2M	1.1M	1.0M	1.9M	0.2M
RZY999ZA2	2.0M	0.0M	0.0M	0.6M	0.0M	1.3M	0.7M	0.6M	1.2M	0.1M
RZY999ZA3	3.0M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZY999ZA4	2.9M	0.0M	0.0M	1.0M	0.0M	1.7M	0.9M	0.8M	1.5M	0.2M
RZY999ZA5	2.8M	0.0M	0.0M	0.8M	0.0M	1.8M	1.0M	0.9M	1.6M	0.2M
RZY999ZA6	2.7M	0.0M	0.0M	0.8M	0.0M	1.7M	0.9M	0.8M	1.5M	0.2M
RZZ000ZA1	2.9M	0.0M	0.0M	0.7M	0.0M	2.0M	1.0M	0.9M	1.7M	0.2M
RZZ000ZA2	1.2M	0.0M	0.0M	0.3M	0.0M	0.9M	0.5M	0.4M	0.8M	0.1M
RZZ000ZA3	3.4M	0.0M	0.0M	0.8M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ000ZA4	4.1M	0.0M	0.0M	0.9M	0.0M	2.9M	1.5M	1.5M	2.7M	0.2M
RZZ000ZA5	5.1M	0.0M	0.0M	1.1M	0.0M	3.7M	1.9M	1.8M	3.2M	0.5M
RZZ000ZA6	3.3M	0.0M	0.0M	0.9M	0.0M	2.1M	1.1M	1.0M	1.9M	0.2M
RZZ014HA1	2.7M	0.0M	0.0M	0.7M	0.0M	1.9M	1.0M	0.9M	1.6M	0.2M
RZZ014HA2	3.1M	0.0M	0.0M	0.7M	0.0M	2.2M	1.1M	1.0M	1.9M	0.2M
RZZ014HA3	3.9M	0.0M	0.0M	1.0M	0.0M	2.6M	1.4M	1.3M	2.4M	0.3M
RZZ014HA4	3.6M	0.0M	0.0M	0.9M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZZ014HA5	3.1M	0.0M	0.0M	0.7M	0.0M	2.2M	1.2M	1.0M	1.9M	0.3M
RZZ014HA6	4.0M	0.0M	0.0M	1.0M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ014LA1	3.8M	0.0M	0.0M	1.0M	0.0M	2.6M	1.3M	1.2M	2.3M	0.3M
RZZ014LA2	3.4M	0.0M	0.0M	0.8M	0.0M	2.4M	1.3M	1.1M	2.1M	0.3M
RZZ014LA3	3.3M	0.0M	0.0M	0.9M	0.0M	2.3M	1.2M	1.1M	2.0M	0.3M
RZZ014LA4	3.1M	0.0M	0.0M	0.8M	0.0M	2.1M	1.1M	1.0M	1.9M	0.2M
RZZ014LA5	4.3M	0.0M	0.0M	0.8M	0.0M	3.3M	1.7M	1.6M	2.8M	0.4M
RZZ014LA6	3.0M	0.0M	0.0M	0.6M	0.0M	2.2M	1.2M	1.1M	1.9M	0.3M
RZZ015HA1	3.7M	0.0M	0.0M	0.9M	0.0M	2.5M	1.3M	1.2M	2.3M	0.3M
RZZ015HA2	3.2M	0.0M	0.0M	0.8M	0.0M	2.2M	1.2M	1.1M	2.0M	0.3M
RZZ015HA3	4.2M	0.0M	0.0M	1.0M	0.0M	3.0M	1.6M	1.5M	2.7M	0.3M
RZZ015HA4	3.1M	0.0M	0.0M	0.8M	0.0M	2.1M	1.1M	1.0M	1.8M	0.2M
RZZ015HA5	4.0M	0.0M	0.0M	1.0M	0.0M	2.8M	1.4M	1.3M	2.4M	0.3M
RZZ015HA6	3.1M	0.0M	0.0M	1.0M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ015LA1	4.1M	0.0M	0.0M	1.0M	0.0M	2.9M	1.5M	1.4M	2.6M	0.3M
RZZ015LA2	4.2M	0.0M	0.0M	0.8M	0.0M	3.1M	1.6M	1.5M	2.8M	0.4M
RZZ015LA3	2.7M	0.0M	0.0M	0.7M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ015LA4	3.5M	0.0M	0.0M	1.0M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ015LA5	4.8M	0.0M	0.0M	1.3M	0.0M	3.2M	1.7M	1.5M	2.8M	0.4M
RZZ015LA6	3.6M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.1M	2.2M	0.3M
RZZ016HA1	3.3M	0.0M	0.0M	0.8M	0.0M	2.2M	1.2M	1.1M	2.0M	0.3M
RZZ016HA2	3.7M	0.0M	0.0M	1.0M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZZ016HA3	3.3M	0.0M	0.0M	0.9M	0.0M	2.2M	1.2M	1.0M	1.9M	0.2M
RZZ016HA4	3.2M	0.0M	0.0M	0.9M	0.0M	2.0M	1.1M	1.0M	1.8M	0.2M
RZZ016HA5	4.2M	0.0M	0.0M	1.3M	0.0M	2.6M	1.4M	1.3M	2.4M	0.3M
RZZ016HA6	2.3M	0.0M	0.0M	0.7M	0.0M	1.5M	0.8M	0.7M	1.3M	0.2M
RZZ016LA1	4.3M	0.0M	0.0M	1.2M	0.0M	2.8M	1.4M	1.3M	2.5M	0.3M
RZZ016LA2	3.5M	0.0M	0.0M	0.7M	0.0M	2.6M	1.3M	1.2M	2.3M	0.3M
RZZ016LA3	3.8M	0.0M	0.0M	0.9M	0.0M	2.6M	1.4M	1.3M	2.3M	0.3M
RZZ016LA4	4.2M	0.0M	0.0M	1.0M	0.0M	2.9M	1.5M	1.4M	2.6M	0.3M
RZZ016LA5	3.3M	0.0M	0.0M	0.8M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ016LA6	3.4M	0.0M	0.0M	0.8M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZZ017HA1	3.0M	0.0M	0.0M	0.8M	0.0M	2.0M	1.0M	0.9M	1.7M	0.2M
RZZ017HA2	3.7M	0.0M	0.0M	1.1M	0.0M	2.3M	1.2M	1.1M	2.1M	0.2M
RZZ017HA3	3.2M	0.0M	0.0M	0.9M	0.0M	2.1M	1.1M	1.0M	1.8M	0.2M
RZZ017HA4	4.2M	0.0M	0.0M	1.2M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ017HA5	2.7M	0.0M	0.0M	0.6M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ017HA6	2.4M	0.0M	0.0M	0.6M	0.0M	1.6M	0.9M	0.8M	1.4M	0.2M
RZZ017LA1	3.5M	0.0M	0.0M	0.9M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ017LA2	3.3M	0.0M	0.0M	0.7M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ017LA3	3.5M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.1M	2.1M	0.3M
RZZ017LA4	3.3M	0.0M	0.0M	0.9M	0.0M	2.2M	1.2M	1.1M	2.0M	0.2M
RZZ017LA5	3.4M	0.0M	0.0M	0.7M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZZ017LA6	2.5M	0.0M	0.0M	0.5M	0.0M	1.9M	1.0M	0.9M	1.6M	0.2M
RZZ018HA1	3.7M	0.0M	0.0M	0.9M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZZ018HA2	3.9M	0.0M	0.0M	0.9M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ018HA3	4.1M	0.0M	0.0M	1.0M	0.0M	2.9M	1.5M	1.4M	2.6M	0.3M
RZZ018HA4	4.0M	0.0M	0.0M	0.9M	0.0M	2.8M	1.4M	1.4M	2.5M	0.3M
RZZ018HA5	4.0M	0.0M	0.0M	1.0M	0.0M	2.8M	1.5M	1.4M	2.5M	0.3M
RZZ018HA6	3.6M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.2M	2.2M	0.3M
RZZ018LA1	2.8M	0.0M	0.0M	0.7M	0.0M	2.0M	1.0M	1.0M	1.7M	0.2M
RZZ018LA2	5.5M	0.0M	0.0M	1.4M	0.0M	3.7M	1.9M	1.8M	3.4M	0.4M
RZZ018LA3	2.5M	0.0M	0.0M	0.7M	0.0M	1.7M	0.9M	0.8M	1.5M	0.2M
RZZ018LA4	3.4M	0.0M	0.0M	0.9M	0.0M	2.2M	1.2M	1.1M	2.0M	0.3M
RZZ018LA5	3.3M	0.0M	0.0M	0.7M	0.0M	2.4M	1.3M	1.2M	2.2M	0.3M
RZZ018LA6	3.6M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.2M	2.2M	0.3M
RZZ019HA1	2.6M	0.0M	0.0M	0.6M	0.0M	1.8M	0.9M	0.8M	1.6M	0.2M
RZZ019HA2	2.8M	0.0M	0.0M	0.7M	0.0M	2.0M	1.1M	0.9M	1.7M	0.2M
RZZ019HA3	4.5M	0.0M	0.0M	1.1M	0.0M	3.2M	1.6M	1.6M	2.9M	0.3M
RZZ019HA4	2.9M	0.0M	0.0M	0.8M	0.0M	2.0M	1.0M	0.9M	1.7M	0.2M
RZZ019HA5	2.2M	0.0M	0.0M	0.5M	0.0M	1.5M	0.8M	0.7M	1.3M	0.2M
RZZ019HA6	3.5M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.1M	2.1M	0.3M
RZZ019LA1	3.8M	0.0M	0.0M	1.1M	0.0M	2.4M	1.2M	1.2M	2.1M	0.3M
RZZ019LA2	2.6M	0.0M	0.0M	0.6M	0.0M	1.9M	1.0M	0.9M	1.6M	0.2M
RZZ019LA3	4.0M	0.0M	0.0M	1.0M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ019LA4	4.2M	0.0M	0.0M	1.1M	0.0M	2.8M	1.5M	1.3M	2.5M	0.3M
RZZ019LA5	4.4M	0.0M	0.0M	0.9M	0.0M	3.2M	1.7M	1.6M	2.8M	0.4M
RZZ019LA6	3.2M	0.0M	0.0M	0.7M	0.0M	2.3M	1.2M	1.1M	2.0M	0.3M
RZZ035HA1	3.5M	0.0M	0.0M	0.9M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ035HA2	3.9M	0.0M	0.0M	0.9M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ035HA3	3.7M	0.0M	0.0M	0.9M	0.0M	2.6M	1.3M	1.2M	2.3M	0.3M
RZZ035HA4	1.9M	0.0M	0.0M	0.6M	0.0M	1.2M	0.6M	0.5M	1.0M	0.1M
RZZ035HA5	3.6M	0.0M	0.0M	0.8M	0.0M	2.6M	1.4M	1.2M	2.3M	0.3M
RZZ035HA6	3.4M	0.0M	0.0M	0.8M	0.0M	2.4M	1.2M	1.1M	2.1M	0.2M
RZZ035LA1	3.2M	0.0M	0.0M	0.8M	0.0M	2.2M	1.2M	1.1M	2.0M	0.3M
RZZ035LA2	2.8M	0.0M	0.0M	0.6M	0.0M	2.1M	1.1M	1.0M	1.8M	0.3M
RZZ035LA3	3.2M	0.0M	0.0M	0.8M	0.0M	2.2M	1.1M	1.0M	1.9M	0.3M
RZZ035LA4	3.4M	0.0M	0.0M	0.9M	0.0M	2.3M	1.2M	1.1M	2.0M	0.2M
RZZ035LA5	4.9M	0.0M	0.0M	1.1M	0.0M	3.5M	1.8M	1.7M	3.0M	0.4M
RZZ035LA6	3.3M	0.0M	0.0M	0.8M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ074HA1	3.6M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.2M	2.2M	0.3M
RZZ074HA2	4.2M	0.0M	0.0M	1.1M	0.0M	2.8M	1.5M	1.3M	2.5M	0.3M
RZZ074HA3	1.9M	0.0M	0.0M	0.5M	0.0M	1.2M	0.6M	0.6M	1.1M	0.1M
RZZ074HA4	3.3M	0.0M	0.0M	0.9M	0.0M	2.2M	1.1M	1.0M	1.9M	0.2M
RZZ074HA5	4.2M	0.0M	0.0M	1.0M	0.0M	3.0M	1.6M	1.5M	2.7M	0.4M
RZZ074HA6	3.5M	0.0M	0.0M	0.9M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ074LA1	3.0M	0.0M	0.0M	0.8M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ074LA2	3.0M	0.0M	0.0M	0.7M	0.0M	2.1M	1.1M	1.0M	1.9M	0.2M
RZZ074LA3	4.5M	0.0M	0.0M	1.1M	0.0M	3.1M	1.6M	1.5M	2.8M	0.4M
RZZ074LA4	3.6M	0.0M	0.0M	1.0M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ074LA5	3.0M	0.0M	0.0M	0.8M	0.0M	2.0M	1.1M	1.0M	1.8M	0.3M
RZZ074LA6	0.5M	0.0M	0.0M	0.1M	0.0M	0.4M	0.2M	0.2M	0.3M	0.1M
RZZ075HA1	4.0M	0.0M	0.0M	1.0M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ075HA2	3.1M	0.0M	0.0M	0.7M	0.0M	2.3M	1.2M	1.1M	2.0M	0.3M
RZZ075HA3	2.6M	0.0M	0.0M	0.7M	0.0M	1.8M	0.9M	0.8M	1.6M	0.2M
RZZ075HA4	3.1M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ075HA5	2.9M	0.0M	0.0M	0.7M	0.0M	2.1M	1.1M	1.0M	1.8M	0.2M
RZZ075HA6	3.8M	0.0M	0.0M	1.0M	0.0M	2.6M	1.3M	1.2M	2.3M	0.3M
RZZ075LA1	4.3M	0.0M	0.0M	1.2M	0.0M	2.8M	1.4M	1.4M	2.5M	0.3M
RZZ075LA2	2.8M	0.0M	0.0M	0.6M	0.0M	2.0M	1.1M	1.0M	1.8M	0.2M
RZZ075LA3	3.7M	0.0M	0.0M	0.8M	0.0M	2.6M	1.4M	1.3M	2.4M	0.3M
RZZ075LA4	3.4M	0.0M	0.0M	0.8M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ075LA5	5.1M	0.0M	0.0M	1.2M	0.0M	3.6M	1.8M	1.7M	3.1M	0.4M
RZZ075LA6	2.7M	0.0M	0.0M	0.6M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ076HA1	3.4M	0.0M	0.0M	0.8M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ076HA2	3.3M	0.0M	0.0M	0.8M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ076HA3	3.4M	0.0M	0.0M	0.9M	0.0M	2.3M	1.2M	1.1M	2.0M	0.3M
RZZ076HA4	2.6M	0.0M	0.0M	0.7M	0.0M	1.7M	0.9M	0.8M	1.5M	0.2M
RZZ076HA5	4.3M	0.0M	0.0M	0.9M	0.0M	3.1M	1.6M	1.5M	2.7M	0.4M
RZZ076HA6	3.2M	0.0M	0.0M	0.8M	0.0M	2.2M	1.1M	1.0M	1.9M	0.3M
RZZ076LA1	3.2M	0.0M	0.0M	0.8M	0.0M	2.2M	1.1M	1.0M	1.9M	0.3M
RZZ076LA2	3.7M	0.0M	0.0M	0.8M	0.0M	2.6M	1.4M	1.3M	2.3M	0.3M
RZZ076LA3	3.5M	0.0M	0.0M	0.8M	0.0M	2.5M	1.3M	1.2M	2.1M	0.3M
RZZ076LA4	3.2M	0.0M	0.0M	0.8M	0.0M	2.2M	1.1M	1.0M	2.0M	0.2M
RZZ076LA5	4.2M	0.0M	0.0M	1.4M	0.0M	2.4M	1.3M	1.2M	2.2M	0.2M
RZZ076LA6	4.1M	0.0M	0.0M	1.0M	0.0M	2.8M	1.4M	1.3M	2.5M	0.3M
RZZ996HA1	3.5M	0.0M	0.0M	1.0M	0.0M	2.3M	1.2M	1.1M	2.0M	0.2M
RZZ996HA2	3.7M	0.0M	0.0M	0.7M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ996HA3	3.0M	0.0M	0.0M	0.8M	0.0M	2.0M	1.1M	1.0M	1.8M	0.2M
RZZ996HA4	3.3M	0.0M	0.0M	0.9M	0.0M	2.2M	1.2M	1.1M	2.0M	0.3M
RZZ996HA5	3.5M	0.0M	0.0M	0.8M	0.0M	2.6M	1.4M	1.2M	2.3M	0.3M
RZZ996HA6	3.7M	0.0M	0.0M	1.1M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ996LA1	3.4M	0.0M	0.0M	0.8M	0.0M	2.4M	1.2M	1.1M	2.1M	0.3M
RZZ996LA2	3.1M	0.0M	0.0M	0.8M	0.0M	2.1M	1.1M	1.0M	1.9M	0.3M
RZZ996LA3	3.5M	0.0M	0.0M	0.9M	0.0M	2.4M	1.3M	1.1M	2.1M	0.3M
RZZ996LA4	4.4M	0.0M	0.0M	1.1M	0.0M	3.0M	1.5M	1.4M	2.6M	0.3M
RZZ996LA5	3.3M	0.0M	0.0M	0.8M	0.0M	2.3M	1.2M	1.1M	2.0M	0.3M
RZZ996LA6	3.0M	0.0M	0.0M	0.9M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ997HA1	3.7M	0.0M	0.0M	1.0M	0.0M	2.5M	1.3M	1.2M	2.3M	0.3M
RZZ997HA2	3.7M	0.0M	0.0M	0.8M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ997HA3	3.8M	0.0M	0.0M	1.0M	0.0M	2.6M	1.3M	1.3M	2.3M	0.3M
RZZ997HA4	4.0M	0.0M	0.0M	1.1M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ997HA5	5.2M	0.0M	0.0M	1.3M	0.0M	3.5M	1.8M	1.7M	3.1M	0.4M
RZZ997HA6	3.0M	0.0M	0.0M	0.8M	0.0M	2.1M	1.1M	1.0M	1.8M	0.2M
RZZ997LA1	3.1M	0.0M	0.0M	0.7M	0.0M	2.2M	1.2M	1.0M	1.9M	0.3M
RZZ997LA2	4.1M	0.0M	0.0M	0.8M	0.0M	3.1M	1.6M	1.5M	2.7M	0.4M
RZZ997LA3	3.1M	0.0M	0.0M	0.8M	0.0M	2.1M	1.1M	1.0M	1.8M	0.2M
RZZ997LA4	3.7M	0.0M	0.0M	0.9M	0.0M	2.6M	1.3M	1.2M	2.3M	0.3M
RZZ997LA5	3.6M	0.0M	0.0M	0.8M	0.0M	2.5M	1.3M	1.2M	2.2M	0.3M
RZZ997LA6	2.6M	0.0M	0.0M	0.6M	0.0M	1.9M	1.0M	0.9M	1.7M	0.2M
RZZ999ZA1	3.5M	0.0M	0.0M	0.9M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ999ZA2	3.1M	0.0M	0.0M	0.6M	0.0M	2.3M	1.2M	1.1M	2.1M	0.3M
RZZ999ZA3	3.0M	0.0M	0.0M	0.8M	0.0M	2.0M	1.1M	1.0M	1.8M	0.2M
RZZ999ZA4	3.9M	0.0M	0.0M	1.0M	0.0M	2.7M	1.4M	1.3M	2.4M	0.3M
RZZ999ZA5	4.3M	0.0M	0.0M	0.9M	0.0M	3.1M	1.6M	1.5M	2.7M	0.4M
RZZ999ZA6	4.2M	0.0M	0.0M	1.1M	0.0M	2.8M	1.5M	1.3M	2.5M	0.3M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: rseqc_bam_stat_table

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non_splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count

Samtools

Toolkit for interacting with BAM/CRAM files.http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Percent mapped

Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.

For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.

Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).

Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.

Created with MultiQC

Alignment stats

This module parses the output from samtools stats. All numbers in millions.

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹³/₁₃ columns.

Sample Name	Total sequences	Mapped & paired	Properly paired	Duplicated	QC Failed	Reads MQ0	Mapped bases (CIGAR)	Bases Trimmed	Duplicated bases	Diff chromosomes	Other orientation	Inward pairs	Outward pairs
RZY000ZA1	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	183.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA2	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	154.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA3	1.7M	0.0M	0.0M	0.0M	0.0M	0.1M	152.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA4	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	200.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA5	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	211.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY000ZA6	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	172.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA1	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	200.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA2	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	187.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA3	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	188.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA4	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	259.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA5	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	203.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019HA6	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	194.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA1	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	135.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA2	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	222.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA3	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	214.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA4	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	187.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA5	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	207.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY019LA6	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	206.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA1	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	206.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA2	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	138.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA3	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	185.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA4	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	167.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA5	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	202.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996LA6	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	190.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA1	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	119.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA2	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	197.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA3	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	184.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA4	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	198.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA5	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	170.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY996MA6	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	166.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA1	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	218.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA2	1.5M	0.0M	0.0M	0.0M	0.0M	0.1M	135.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA3	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	194.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA4	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	172.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA5	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	186.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZY999ZA6	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	172.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA1	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	211.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA2	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	93.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA3	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	255.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA4	3.2M	0.0M	0.0M	0.0M	0.0M	0.1M	305.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA5	4.0M	0.0M	0.0M	0.0M	0.0M	0.1M	403.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ000ZA6	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	210.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA1	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	202.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA2	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	225.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA3	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	272.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA4	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	255.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA5	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	232.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014HA6	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	285.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA1	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	274.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA2	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	250.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA3	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	241.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA4	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	220.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA5	3.5M	0.0M	0.0M	0.0M	0.0M	0.1M	364.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ014LA6	2.4M	0.0M	0.0M	0.0M	0.0M	0.0M	246.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA1	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	272.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA2	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	240.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA3	3.3M	0.0M	0.0M	0.0M	0.0M	0.1M	320.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA4	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	215.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA5	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	298.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015HA6	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	183.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA1	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	307.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA2	3.4M	0.0M	0.0M	0.0M	0.0M	0.1M	338.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA3	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	198.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA4	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	236.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA5	3.5M	0.0M	0.0M	0.0M	0.0M	0.1M	340.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ015LA6	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	250.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA1	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	240.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA2	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	256.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA3	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	230.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA4	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	209.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA5	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	262.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016HA6	1.6M	0.0M	0.0M	0.0M	0.0M	0.1M	150.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA1	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	285.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA2	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	273.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA3	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	276.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA4	3.2M	0.0M	0.0M	0.0M	0.0M	0.1M	299.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA5	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	253.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ016LA6	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	258.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA1	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	209.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA2	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	234.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA3	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	215.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA4	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	271.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA5	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	200.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017HA6	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	172.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA1	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	243.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA2	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	251.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA3	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	254.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA4	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	230.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA5	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	266.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ017LA6	2.0M	0.0M	0.0M	0.0M	0.0M	0.0M	214.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA1	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	264.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA2	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	290.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA3	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	307.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA4	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	294.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA5	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	303.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018HA6	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	253.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA1	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	216.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA2	4.1M	0.0M	0.0M	0.0M	0.0M	0.1M	373.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA3	1.8M	0.0M	0.0M	0.0M	0.0M	0.1M	175.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA4	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	229.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA5	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	263.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ018LA6	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	252.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA1	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	190.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA2	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	206.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA3	3.5M	0.0M	0.0M	0.0M	0.0M	0.1M	337.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA4	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	205.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA5	1.7M	0.0M	0.0M	0.0M	0.0M	0.0M	164.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019HA6	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	247.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA1	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	250.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA2	2.0M	0.0M	0.0M	0.0M	0.0M	0.0M	198.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA3	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	293.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA4	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	289.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA5	3.5M	0.0M	0.0M	0.0M	0.0M	0.1M	355.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ019LA6	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	242.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA1	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	254.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA2	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	284.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA3	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	275.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA4	1.3M	0.0M	0.0M	0.0M	0.0M	0.1M	118.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA5	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	279.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035HA6	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	245.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA1	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	240.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA2	2.3M	0.0M	0.0M	0.0M	0.0M	0.0M	229.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA3	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	228.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA4	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	230.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA5	3.8M	0.0M	0.0M	0.0M	0.0M	0.1M	366.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ035LA6	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	246.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA1	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	260.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA2	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	286.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA3	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	125.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA4	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	222.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA5	3.3M	0.0M	0.0M	0.0M	0.0M	0.1M	328.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074HA6	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	245.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA1	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	205.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA2	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	222.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA3	3.4M	0.0M	0.0M	0.0M	0.0M	0.1M	336.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA4	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	238.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA5	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	218.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ074LA6	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	50.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA1	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	279.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA2	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	248.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA3	2.0M	0.0M	0.0M	0.0M	0.0M	0.1M	188.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA4	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	196.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA5	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	219.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075HA6	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	264.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA1	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	290.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA2	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	217.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA3	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	283.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA4	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	245.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA5	3.9M	0.0M	0.0M	0.0M	0.0M	0.1M	373.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ075LA6	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	202.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA1	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	253.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA2	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	245.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA3	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	241.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA4	1.9M	0.0M	0.0M	0.0M	0.0M	0.1M	176.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA5	3.4M	0.0M	0.0M	0.0M	0.0M	0.1M	338.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076HA6	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	224.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA1	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	230.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA2	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	280.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA3	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	266.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA4	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	226.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA5	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	219.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ076LA6	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	288.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA1	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	236.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA2	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	292.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA3	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	211.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA4	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	229.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA5	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	279.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996HA6	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	235.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA1	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	254.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA2	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	226.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA3	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	251.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA4	3.2M	0.0M	0.0M	0.0M	0.0M	0.1M	302.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA5	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	244.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ996LA6	2.1M	0.0M	0.0M	0.0M	0.0M	0.1M	191.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA1	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	265.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA2	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	278.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA3	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	279.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA4	3.0M	0.0M	0.0M	0.0M	0.0M	0.1M	280.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA5	3.9M	0.0M	0.0M	0.0M	0.0M	0.1M	376.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997HA6	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	216.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA1	2.4M	0.0M	0.0M	0.0M	0.0M	0.1M	235.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA2	3.3M	0.0M	0.0M	0.0M	0.0M	0.1M	331.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA3	2.3M	0.0M	0.0M	0.0M	0.0M	0.1M	219.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA4	2.8M	0.0M	0.0M	0.0M	0.0M	0.1M	266.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA5	2.7M	0.0M	0.0M	0.0M	0.0M	0.1M	271.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ997LA6	2.0M	0.0M	0.0M	0.0M	0.0M	0.0M	196.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA1	2.6M	0.0M	0.0M	0.0M	0.0M	0.1M	247.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA2	2.5M	0.0M	0.0M	0.0M	0.0M	0.1M	252.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA3	2.2M	0.0M	0.0M	0.0M	0.0M	0.1M	214.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA4	2.9M	0.0M	0.0M	0.0M	0.0M	0.1M	281.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA5	3.4M	0.0M	0.0M	0.0M	0.0M	0.1M	343.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
RZZ999ZA6	3.1M	0.0M	0.0M	0.0M	0.0M	0.1M	288.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-stats-dp_table

Sort	Column	Description	ID	Scale
\|\|	Total sequences	Total sequences	`raw_total_sequences`	read_count
\|\|	Mapped & paired	Paired-end technology bit set + both mates mapped	`reads_mapped_and_paired`	read_count
\|\|	Properly paired	Proper-pair bit set	`reads_properly_paired`	read_count
\|\|	Duplicated	PCR or optical duplicate bit set	`reads_duplicated`	read_count
\|\|	QC Failed	QC Failed	`reads_QC_failed`	read_count
\|\|	Reads MQ0	Reads mapped and MQ=0	`reads_MQ0`	read_count
\|\|	Mapped bases (CIGAR)	Mapped bases (CIGAR)	`bases_mapped__cigar`	base_count
\|\|	Bases Trimmed	Bases Trimmed	`bases_trimmed`	base_count
\|\|	Duplicated bases	Duplicated bases	`bases_duplicated`	base_count
\|\|	Diff chromosomes	Pairs on different chromosomes	`pairs_on_different_chromosomes`	read_count
\|\|	Other orientation	Pairs with other orientation	`pairs_with_other_orientation`	read_count
\|\|	Inward pairs	Inward oriented pairs	`inward_oriented_pairs`	read_count
\|\|	Outward pairs	Outward oriented pairs	`outward_oriented_pairs`	read_count

Flagstat

This module parses the output from samtools flagstat

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
RZY000ZA1	2.9M	2.9M	2.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA2	2.5M	2.5M	2.5M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA3	2.5M	2.5M	2.5M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA4	3.2M	3.2M	3.2M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA5	3.1M	3.1M	3.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY000ZA6	2.7M	2.7M	2.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA1	3.1M	3.1M	3.1M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA2	2.8M	2.8M	2.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA3	2.9M	2.9M	2.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA4	3.7M	3.7M	3.7M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA5	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019HA6	3.0M	3.0M	3.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA1	2.2M	2.2M	2.2M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA2	3.6M	3.6M	3.6M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA3	3.4M	3.4M	3.4M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA4	3.1M	3.1M	3.1M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA5	3.1M	3.1M	3.1M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY019LA6	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA1	3.4M	3.4M	3.4M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA2	2.2M	2.2M	2.2M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA3	2.9M	2.9M	2.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA4	2.8M	2.8M	2.8M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA5	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996LA6	3.0M	3.0M	3.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA1	2.3M	2.3M	2.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA2	3.0M	3.0M	3.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA3	2.8M	2.8M	2.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA4	3.0M	3.0M	3.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA5	2.7M	2.7M	2.7M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY996MA6	2.6M	2.6M	2.6M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA1	3.7M	3.7M	3.7M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA2	2.0M	2.0M	2.0M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA3	3.0M	3.0M	3.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA4	2.9M	2.9M	2.9M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA5	2.8M	2.8M	2.8M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZY999ZA6	2.7M	2.7M	2.7M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA1	2.9M	2.9M	2.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA2	1.2M	1.2M	1.2M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA3	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA4	4.1M	4.1M	4.1M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA5	5.1M	5.1M	5.1M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ000ZA6	3.3M	3.3M	3.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA1	2.7M	2.7M	2.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA2	3.1M	3.1M	3.1M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA3	3.9M	3.9M	3.9M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA4	3.6M	3.6M	3.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA5	3.1M	3.1M	3.1M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014HA6	4.0M	4.0M	4.0M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA1	3.8M	3.8M	3.8M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA2	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA3	3.3M	3.3M	3.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA4	3.1M	3.1M	3.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA5	4.3M	4.3M	4.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ014LA6	3.0M	3.0M	3.0M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA1	3.7M	3.7M	3.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA2	3.2M	3.2M	3.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA3	4.2M	4.2M	4.2M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA4	3.1M	3.1M	3.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA5	4.0M	4.0M	4.0M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015HA6	3.1M	3.1M	3.1M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA1	4.1M	4.1M	4.1M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA2	4.2M	4.2M	4.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA3	2.7M	2.7M	2.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA4	3.5M	3.5M	3.5M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA5	4.8M	4.8M	4.8M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ015LA6	3.6M	3.6M	3.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA1	3.3M	3.3M	3.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA2	3.7M	3.7M	3.7M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA3	3.3M	3.3M	3.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA4	3.2M	3.2M	3.2M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA5	4.2M	4.2M	4.2M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016HA6	2.3M	2.3M	2.3M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA1	4.3M	4.3M	4.3M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA2	3.5M	3.5M	3.5M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA3	3.8M	3.8M	3.8M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA4	4.2M	4.2M	4.2M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA5	3.3M	3.3M	3.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ016LA6	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA1	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA2	3.7M	3.7M	3.7M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA3	3.2M	3.2M	3.2M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA4	4.2M	4.2M	4.2M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA5	2.7M	2.7M	2.7M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017HA6	2.4M	2.4M	2.4M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA1	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA2	3.3M	3.3M	3.3M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA3	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA4	3.3M	3.3M	3.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA5	3.4M	3.4M	3.4M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ017LA6	2.5M	2.5M	2.5M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA1	3.7M	3.7M	3.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA2	3.9M	3.9M	3.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA3	4.1M	4.1M	4.1M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA4	4.0M	4.0M	4.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA5	4.0M	4.0M	4.0M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018HA6	3.6M	3.6M	3.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA1	2.8M	2.8M	2.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA2	5.5M	5.5M	5.5M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA3	2.5M	2.5M	2.5M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA4	3.4M	3.4M	3.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA5	3.3M	3.3M	3.3M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ018LA6	3.6M	3.6M	3.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA1	2.6M	2.6M	2.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA2	2.8M	2.8M	2.8M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA3	4.5M	4.5M	4.5M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA4	2.9M	2.9M	2.9M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA5	2.2M	2.2M	2.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019HA6	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA1	3.8M	3.8M	3.8M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA2	2.6M	2.6M	2.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA3	4.0M	4.0M	4.0M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA4	4.2M	4.2M	4.2M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA5	4.4M	4.4M	4.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ019LA6	3.2M	3.2M	3.2M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA1	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA2	3.9M	3.9M	3.9M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA3	3.7M	3.7M	3.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA4	1.9M	1.9M	1.9M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA5	3.6M	3.6M	3.6M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035HA6	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA1	3.2M	3.2M	3.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA2	2.8M	2.8M	2.8M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA3	3.2M	3.2M	3.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA4	3.4M	3.4M	3.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA5	4.9M	4.9M	4.9M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ035LA6	3.3M	3.3M	3.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA1	3.6M	3.6M	3.6M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA2	4.2M	4.2M	4.2M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA3	1.9M	1.9M	1.9M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA4	3.3M	3.3M	3.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA5	4.2M	4.2M	4.2M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074HA6	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA1	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA2	3.0M	3.0M	3.0M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA3	4.5M	4.5M	4.5M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA4	3.6M	3.6M	3.6M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA5	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ074LA6	0.5M	0.5M	0.5M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA1	4.0M	4.0M	4.0M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA2	3.1M	3.1M	3.1M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA3	2.6M	2.6M	2.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA4	3.1M	3.1M	3.1M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA5	2.9M	2.9M	2.9M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075HA6	3.8M	3.8M	3.8M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA1	4.3M	4.3M	4.3M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA2	2.8M	2.8M	2.8M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA3	3.7M	3.7M	3.7M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA4	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA5	5.1M	5.1M	5.1M	1.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ075LA6	2.7M	2.7M	2.7M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA1	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA2	3.3M	3.3M	3.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA3	3.4M	3.4M	3.4M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA4	2.6M	2.6M	2.6M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA5	4.3M	4.3M	4.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076HA6	3.2M	3.2M	3.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA1	3.2M	3.2M	3.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA2	3.7M	3.7M	3.7M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA3	3.5M	3.5M	3.5M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA4	3.2M	3.2M	3.2M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA5	4.2M	4.2M	4.2M	1.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ076LA6	4.1M	4.1M	4.1M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA1	3.5M	3.5M	3.5M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA2	3.7M	3.7M	3.7M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA3	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA4	3.3M	3.3M	3.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA5	3.5M	3.5M	3.5M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996HA6	3.7M	3.7M	3.7M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA1	3.4M	3.4M	3.4M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA2	3.1M	3.1M	3.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA3	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA4	4.4M	4.4M	4.4M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA5	3.3M	3.3M	3.3M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ996LA6	3.0M	3.0M	3.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA1	3.7M	3.7M	3.7M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA2	3.7M	3.7M	3.7M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA3	3.8M	3.8M	3.8M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA4	4.0M	4.0M	4.0M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA5	5.2M	5.2M	5.2M	1.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997HA6	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA1	3.1M	3.1M	3.1M	0.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA2	4.1M	4.1M	4.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA3	3.1M	3.1M	3.1M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA4	3.7M	3.7M	3.7M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA5	3.6M	3.6M	3.6M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ997LA6	2.6M	2.6M	2.6M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA1	3.5M	3.5M	3.5M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA2	3.1M	3.1M	3.1M	0.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA3	3.0M	3.0M	3.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA4	3.9M	3.9M	3.9M	1.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA5	4.3M	4.3M	4.3M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
RZZ999ZA6	4.2M	4.2M	4.2M	1.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-table_table

Sort	Column	Description	ID	Scale
\|\|	Total Reads	Total Reads	`flagstat_total`	read_count
\|\|	Total Passed QC	Total Passed QC	`total_passed`	read_count
\|\|	Mapped	Mapped	`mapped_passed`	read_count
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed`	read_count
\|\|	Duplicates	Duplicates	`duplicates_passed`	read_count
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed`	read_count
\|\|	Properly Paired	Properly Paired	`properly_paired_passed`	read_count
\|\|	Self and mate mapped	Reads with itself and mate mapped	`with_itself_and_mate_mapped_passed`	read_count
\|\|	Singletons	Singletons	`singletons_passed`	read_count
\|\|	Mate mapped to diff chr	Mate mapped to different chromosome	`with_mate_mapped_to_a_different_chr_passed`	read_count
\|\|	Diff chr (mapQ >= 5)	Mate mapped to different chromosome (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed`	read_count

Flagstat: Percentage of total

This module parses the output from samtools flagstat

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
RZY000ZA1	100.0%	100.0%	100.0%	30.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA2	100.0%	100.0%	100.0%	31.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA3	100.0%	100.0%	100.0%	31.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA4	100.0%	100.0%	100.0%	31.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA5	100.0%	100.0%	100.0%	27.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY000ZA6	100.0%	100.0%	100.0%	31.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA1	100.0%	100.0%	100.0%	29.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA2	100.0%	100.0%	100.0%	28.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA3	100.0%	100.0%	100.0%	29.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA4	100.0%	100.0%	100.0%	27.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA5	100.0%	100.0%	100.0%	28.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019HA6	100.0%	100.0%	100.0%	29.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA1	100.0%	100.0%	100.0%	32.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA2	100.0%	100.0%	100.0%	31.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA3	100.0%	100.0%	100.0%	30.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA4	100.0%	100.0%	100.0%	31.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA5	100.0%	100.0%	100.0%	28.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY019LA6	100.0%	100.0%	100.0%	28.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA1	100.0%	100.0%	100.0%	32.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA2	100.0%	100.0%	100.0%	30.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA3	100.0%	100.0%	100.0%	29.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA4	100.0%	100.0%	100.0%	33.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA5	100.0%	100.0%	100.0%	28.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996LA6	100.0%	100.0%	100.0%	30.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA1	100.0%	100.0%	100.0%	36.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA2	100.0%	100.0%	100.0%	28.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA3	100.0%	100.0%	100.0%	28.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA4	100.0%	100.0%	100.0%	29.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA5	100.0%	100.0%	100.0%	31.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY996MA6	100.0%	100.0%	100.0%	29.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA1	100.0%	100.0%	100.0%	33.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA2	100.0%	100.0%	100.0%	28.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA3	100.0%	100.0%	100.0%	29.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA4	100.0%	100.0%	100.0%	33.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA5	100.0%	100.0%	100.0%	29.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZY999ZA6	100.0%	100.0%	100.0%	29.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA1	100.0%	100.0%	100.0%	24.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA2	100.0%	100.0%	100.0%	22.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA3	100.0%	100.0%	100.0%	23.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA4	100.0%	100.0%	100.0%	22.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA5	100.0%	100.0%	100.0%	21.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ000ZA6	100.0%	100.0%	100.0%	28.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA1	100.0%	100.0%	100.0%	24.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA2	100.0%	100.0%	100.0%	23.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA3	100.0%	100.0%	100.0%	26.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA4	100.0%	100.0%	100.0%	25.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA5	100.0%	100.0%	100.0%	23.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014HA6	100.0%	100.0%	100.0%	24.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA1	100.0%	100.0%	100.0%	25.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA2	100.0%	100.0%	100.0%	23.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA3	100.0%	100.0%	100.0%	25.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA4	100.0%	100.0%	100.0%	25.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA5	100.0%	100.0%	100.0%	19.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ014LA6	100.0%	100.0%	100.0%	19.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA1	100.0%	100.0%	100.0%	24.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA2	100.0%	100.0%	100.0%	23.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA3	100.0%	100.0%	100.0%	22.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA4	100.0%	100.0%	100.0%	25.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA5	100.0%	100.0%	100.0%	24.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015HA6	100.0%	100.0%	100.0%	31.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA1	100.0%	100.0%	100.0%	24.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA2	100.0%	100.0%	100.0%	20.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA3	100.0%	100.0%	100.0%	24.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA4	100.0%	100.0%	100.0%	27.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA5	100.0%	100.0%	100.0%	26.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ015LA6	100.0%	100.0%	100.0%	25.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA1	100.0%	100.0%	100.0%	25.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA2	100.0%	100.0%	100.0%	26.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA3	100.0%	100.0%	100.0%	26.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA4	100.0%	100.0%	100.0%	28.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA5	100.0%	100.0%	100.0%	30.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016HA6	100.0%	100.0%	100.0%	28.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA1	100.0%	100.0%	100.0%	28.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA2	100.0%	100.0%	100.0%	20.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA3	100.0%	100.0%	100.0%	24.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA4	100.0%	100.0%	100.0%	24.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA5	100.0%	100.0%	100.0%	23.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ016LA6	100.0%	100.0%	100.0%	22.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA1	100.0%	100.0%	100.0%	27.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA2	100.0%	100.0%	100.0%	29.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA3	100.0%	100.0%	100.0%	27.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA4	100.0%	100.0%	100.0%	28.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA5	100.0%	100.0%	100.0%	23.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017HA6	100.0%	100.0%	100.0%	25.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA1	100.0%	100.0%	100.0%	26.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA2	100.0%	100.0%	100.0%	22.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA3	100.0%	100.0%	100.0%	24.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA4	100.0%	100.0%	100.0%	25.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA5	100.0%	100.0%	100.0%	21.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ017LA6	100.0%	100.0%	100.0%	18.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA1	100.0%	100.0%	100.0%	25.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA2	100.0%	100.0%	100.0%	23.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA3	100.0%	100.0%	100.0%	24.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA4	100.0%	100.0%	100.0%	23.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA5	100.0%	100.0%	100.0%	23.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018HA6	100.0%	100.0%	100.0%	25.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA1	100.0%	100.0%	100.0%	23.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA2	100.0%	100.0%	100.0%	26.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA3	100.0%	100.0%	100.0%	26.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA4	100.0%	100.0%	100.0%	27.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA5	100.0%	100.0%	100.0%	21.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ018LA6	100.0%	100.0%	100.0%	25.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA1	100.0%	100.0%	100.0%	24.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA2	100.0%	100.0%	100.0%	23.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA3	100.0%	100.0%	100.0%	23.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA4	100.0%	100.0%	100.0%	25.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA5	100.0%	100.0%	100.0%	24.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019HA6	100.0%	100.0%	100.0%	25.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA1	100.0%	100.0%	100.0%	28.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA2	100.0%	100.0%	100.0%	21.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA3	100.0%	100.0%	100.0%	24.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA4	100.0%	100.0%	100.0%	25.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA5	100.0%	100.0%	100.0%	21.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ019LA6	100.0%	100.0%	100.0%	21.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA1	100.0%	100.0%	100.0%	25.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA2	100.0%	100.0%	100.0%	23.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA3	100.0%	100.0%	100.0%	24.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA4	100.0%	100.0%	100.0%	30.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA5	100.0%	100.0%	100.0%	22.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035HA6	100.0%	100.0%	100.0%	23.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA1	100.0%	100.0%	100.0%	24.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA2	100.0%	100.0%	100.0%	19.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA3	100.0%	100.0%	100.0%	26.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA4	100.0%	100.0%	100.0%	26.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA5	100.0%	100.0%	100.0%	23.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ035LA6	100.0%	100.0%	100.0%	23.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA1	100.0%	100.0%	100.0%	24.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA2	100.0%	100.0%	100.0%	27.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA3	100.0%	100.0%	100.0%	29.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA4	100.0%	100.0%	100.0%	27.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA5	100.0%	100.0%	100.0%	22.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074HA6	100.0%	100.0%	100.0%	25.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA1	100.0%	100.0%	100.0%	28.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA2	100.0%	100.0%	100.0%	24.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA3	100.0%	100.0%	100.0%	23.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA4	100.0%	100.0%	100.0%	27.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA5	100.0%	100.0%	100.0%	25.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ074LA6	100.0%	100.0%	100.0%	13.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA1	100.0%	100.0%	100.0%	26.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA2	100.0%	100.0%	100.0%	21.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA3	100.0%	100.0%	100.0%	26.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA4	100.0%	100.0%	100.0%	29.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA5	100.0%	100.0%	100.0%	23.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075HA6	100.0%	100.0%	100.0%	25.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA1	100.0%	100.0%	100.0%	27.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA2	100.0%	100.0%	100.0%	22.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA3	100.0%	100.0%	100.0%	22.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA4	100.0%	100.0%	100.0%	24.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA5	100.0%	100.0%	100.0%	23.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ075LA6	100.0%	100.0%	100.0%	23.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA1	100.0%	100.0%	100.0%	24.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA2	100.0%	100.0%	100.0%	23.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA3	100.0%	100.0%	100.0%	25.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA4	100.0%	100.0%	100.0%	26.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA5	100.0%	100.0%	100.0%	21.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076HA6	100.0%	100.0%	100.0%	25.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA1	100.0%	100.0%	100.0%	25.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA2	100.0%	100.0%	100.0%	23.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA3	100.0%	100.0%	100.0%	23.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA4	100.0%	100.0%	100.0%	25.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA5	100.0%	100.0%	100.0%	33.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ076LA6	100.0%	100.0%	100.0%	24.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA1	100.0%	100.0%	100.0%	27.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA2	100.0%	100.0%	100.0%	20.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA3	100.0%	100.0%	100.0%	25.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA4	100.0%	100.0%	100.0%	26.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA5	100.0%	100.0%	100.0%	21.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996HA6	100.0%	100.0%	100.0%	28.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA1	100.0%	100.0%	100.0%	24.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA2	100.0%	100.0%	100.0%	24.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA3	100.0%	100.0%	100.0%	24.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA4	100.0%	100.0%	100.0%	25.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA5	100.0%	100.0%	100.0%	24.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ996LA6	100.0%	100.0%	100.0%	29.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA1	100.0%	100.0%	100.0%	25.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA2	100.0%	100.0%	100.0%	22.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA3	100.0%	100.0%	100.0%	24.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA4	100.0%	100.0%	100.0%	26.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA5	100.0%	100.0%	100.0%	25.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997HA6	100.0%	100.0%	100.0%	25.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA1	100.0%	100.0%	100.0%	23.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA2	100.0%	100.0%	100.0%	19.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA3	100.0%	100.0%	100.0%	25.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA4	100.0%	100.0%	100.0%	24.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA5	100.0%	100.0%	100.0%	23.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ997LA6	100.0%	100.0%	100.0%	22.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA1	100.0%	100.0%	100.0%	26.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA2	100.0%	100.0%	100.0%	20.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA3	100.0%	100.0%	100.0%	26.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA4	100.0%	100.0%	100.0%	25.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA5	100.0%	100.0%	100.0%	21.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
RZZ999ZA6	100.0%	100.0%	100.0%	26.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-pct-table_table

Sort	Column	Description	ID
\|\|	Total Reads	Total Reads	`flagstat_total_pct`
\|\|	Total Passed QC	Total Passed QC	`total_passed_pct`
\|\|	Mapped	Mapped	`mapped_passed_pct`
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed_pct`
\|\|	Duplicates	Duplicates	`duplicates_passed_pct`
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed_pct`
\|\|	Properly Paired	Properly Paired	`properly_paired_passed_pct`
\|\|	Self and mate mapped	Self and mate mapped	`with_itself_and_mate_mapped_passed_pct`
\|\|	Singletons	Singletons	`singletons_passed_pct`
\|\|	Mate mapped to diff chr	Mate mapped to diff chr	`with_mate_mapped_to_a_different_chr_passed_pct`
\|\|	Diff chr (mapQ >= 5)	Diff chr (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed_pct`

Mapped reads per contig

The samtools idxstats tool counts the number of mapped reads per chromosome / contig. Chromosomes with < 0.1% of the total aligned reads are omitted from this plot.

Created with MultiQC

STAR

Universal RNA-seq aligner.https://github.com/alexdobin/STARDOI: 10.1093/bioinformatics/bts635

Summary Statistics

Summary statistics from the STAR alignment

Showing ¹⁹²/₁₉₂ rows and ¹⁰/₁₉ columns.

Sample Name	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	Avg. read len	Avg. mapped len	Splices	Annotated splices	GT/AG splices	GC/AG splices	AT/AC splices	Non-canonical splices	Mismatch rate	Del rate	Del len	Ins rate	Ins len
RZY000ZA1	18.9M	17.6M	93.0%	16.4M	86.4%	1.2M	92.0bp	96.7bp	1.8M	1.8M	1.7M	0.1M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY000ZA2	8.9M	7.9M	89.5%	7.2M	81.6%	0.7M	86.0bp	94.1bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY000ZA3	9.6M	8.9M	92.2%	8.0M	83.3%	0.9M	88.0bp	93.9bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY000ZA4	11.8M	10.8M	91.0%	9.8M	82.5%	1.0M	86.0bp	92.7bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY000ZA5	9.7M	8.9M	91.7%	8.1M	83.9%	0.8M	91.0bp	96.9bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZY000ZA6	9.8M	8.8M	89.4%	8.0M	81.3%	0.8M	87.0bp	95.7bp	1.0M	1.0M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY019HA1	9.1M	8.2M	90.7%	7.4M	81.6%	0.8M	87.0bp	94.0bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZY019HA2	8.4M	7.6M	91.0%	6.9M	82.2%	0.7M	87.0bp	94.2bp	0.6M	0.6M	0.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZY019HA3	11.5M	10.6M	92.3%	9.6M	83.5%	1.0M	87.0bp	93.2bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY019HA4	12.7M	11.7M	92.2%	10.7M	84.7%	1.0M	93.0bp	98.3bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZY019HA5	10.5M	9.6M	91.6%	8.8M	83.5%	0.8M	91.0bp	97.0bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZY019HA6	11.1M	10.1M	91.4%	9.3M	83.8%	0.8M	88.0bp	94.6bp	1.0M	1.0M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZY019LA1	9.0M	8.2M	91.6%	7.3M	81.6%	0.9M	85.0bp	91.8bp	0.8M	0.8M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZY019LA2	15.2M	13.8M	90.6%	12.4M	81.9%	1.3M	85.0bp	92.1bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY019LA3	13.0M	11.8M	90.7%	10.8M	83.2%	1.0M	88.0bp	94.7bp	1.1M	1.1M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZY019LA4	12.2M	11.2M	91.3%	10.2M	83.8%	0.9M	86.0bp	93.0bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY019LA5	12.5M	11.5M	91.9%	10.5M	84.3%	0.9M	91.0bp	96.6bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZY019LA6	10.7M	9.8M	91.1%	9.0M	83.8%	0.8M	90.0bp	97.3bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996LA1	22.6M	20.8M	92.2%	18.8M	83.2%	2.0M	88.0bp	94.0bp	1.9M	1.9M	1.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996LA2	10.0M	9.1M	90.7%	8.2M	81.9%	0.9M	89.0bp	96.2bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996LA3	9.2M	8.5M	92.1%	7.8M	84.8%	0.7M	87.0bp	93.1bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996LA4	10.1M	9.0M	89.5%	8.1M	80.2%	0.9M	84.0bp	92.5bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZY996LA5	11.6M	10.7M	92.6%	9.8M	85.0%	0.9M	91.0bp	96.6bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996LA6	11.3M	10.3M	90.9%	9.4M	82.8%	0.9M	86.0bp	93.0bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZY996MA1	14.1M	12.6M	89.1%	11.2M	79.3%	1.4M	73.0bp	79.6bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZY996MA2	10.4M	9.6M	92.7%	8.9M	85.7%	0.7M	88.0bp	93.6bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996MA3	10.0M	9.3M	92.5%	8.6M	85.9%	0.7M	90.0bp	95.6bp	0.9M	0.9M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.0bp
RZY996MA4	10.6M	9.6M	90.9%	8.8M	83.5%	0.8M	89.0bp	95.7bp	1.0M	1.0M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996MA5	9.8M	8.9M	91.2%	8.1M	83.1%	0.8M	86.0bp	92.5bp	0.8M	0.8M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY996MA6	10.1M	9.2M	91.6%	8.4M	83.3%	0.8M	87.0bp	93.8bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY999ZA1	24.2M	22.0M	90.9%	19.6M	81.2%	2.4M	87.0bp	93.8bp	2.1M	2.1M	2.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY999ZA2	6.9M	6.3M	91.9%	5.8M	84.8%	0.5M	89.0bp	95.6bp	0.6M	0.6M	0.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY999ZA3	10.9M	10.0M	91.9%	9.1M	83.4%	0.9M	88.0bp	94.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY999ZA4	11.1M	10.0M	90.1%	9.0M	81.0%	1.0M	86.0bp	94.1bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY999ZA5	9.6M	8.8M	91.8%	8.0M	83.0%	0.8M	88.0bp	94.3bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZY999ZA6	10.3M	9.5M	92.1%	8.6M	84.2%	0.8M	88.0bp	94.2bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ000ZA1	11.7M	11.2M	95.5%	10.4M	88.5%	0.8M	100.0bp	102.7bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ000ZA2	8.2M	7.9M	95.9%	7.5M	91.5%	0.4M	97.0bp	98.1bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.8%	0.0%	2.5bp	0.0%	2.1bp
RZZ000ZA3	14.1M	13.5M	96.1%	12.6M	89.8%	0.9M	99.0bp	101.3bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ000ZA4	17.8M	17.2M	96.4%	16.1M	90.2%	1.1M	99.0bp	100.2bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.8%	0.1%	2.4bp	0.0%	2.1bp
RZZ000ZA5	21.1M	20.2M	96.0%	19.0M	90.5%	1.2M	102.0bp	103.6bp	2.4M	2.4M	2.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ000ZA6	14.9M	14.0M	93.6%	12.9M	86.3%	1.1M	88.0bp	92.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014HA1	12.7M	12.2M	96.0%	11.4M	89.3%	0.9M	100.0bp	101.7bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014HA2	15.0M	14.5M	96.6%	13.9M	92.3%	0.6M	96.0bp	97.0bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ014HA3	12.7M	12.1M	95.1%	11.1M	87.2%	1.0M	91.0bp	94.0bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014HA4	16.8M	16.1M	95.8%	14.7M	87.5%	1.4M	96.0bp	98.3bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014HA5	14.6M	14.0M	96.1%	13.2M	90.7%	0.8M	99.0bp	101.2bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.0bp
RZZ014HA6	16.1M	15.5M	96.3%	14.1M	87.8%	1.4M	96.0bp	97.6bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014LA1	15.0M	14.2M	95.1%	13.2M	87.9%	1.1M	97.0bp	100.3bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.8%	0.1%	2.4bp	0.0%	2.0bp
RZZ014LA2	15.8M	15.2M	96.1%	14.3M	90.3%	0.9M	97.0bp	99.1bp	1.7M	1.7M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ014LA3	15.2M	14.5M	95.8%	13.5M	89.2%	1.0M	98.0bp	99.9bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014LA4	13.7M	13.1M	95.7%	12.1M	88.5%	1.0M	95.0bp	97.9bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ014LA5	15.8M	15.2M	96.0%	14.4M	90.8%	0.8M	104.0bp	105.9bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZZ014LA6	11.7M	11.3M	96.4%	10.6M	90.5%	0.7M	109.0bp	110.4bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ015HA1	14.9M	14.2M	95.6%	13.3M	89.1%	1.0M	97.0bp	99.3bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ015HA2	11.4M	10.8M	94.9%	10.1M	88.8%	0.7M	95.0bp	98.1bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ015HA3	16.0M	15.3M	96.0%	14.3M	89.4%	1.1M	99.0bp	100.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ015HA4	13.8M	13.2M	95.9%	12.2M	88.7%	1.0M	95.0bp	97.6bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ015HA5	18.6M	17.9M	96.1%	16.6M	89.1%	1.3M	99.0bp	101.2bp	1.9M	1.9M	1.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ015HA6	15.5M	14.4M	92.9%	13.4M	86.6%	1.0M	82.0bp	86.5bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ015LA1	14.4M	13.7M	95.2%	12.8M	88.5%	1.0M	97.0bp	99.9bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.8%	0.1%	2.4bp	0.0%	2.0bp
RZZ015LA2	15.2M	14.6M	96.4%	13.8M	91.3%	0.8M	100.0bp	101.1bp	1.6M	1.6M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ015LA3	12.7M	12.2M	95.8%	11.3M	89.4%	0.8M	98.0bp	100.2bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ015LA4	14.8M	14.1M	95.5%	12.9M	87.5%	1.2M	93.0bp	95.7bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ015LA5	17.5M	16.5M	94.0%	15.3M	87.1%	1.2M	92.0bp	96.4bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ015LA6	16.0M	15.3M	95.8%	14.1M	88.7%	1.1M	95.0bp	97.0bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ016HA1	15.3M	14.6M	96.0%	13.7M	89.6%	1.0M	99.0bp	101.0bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ016HA2	16.9M	16.2M	95.8%	15.1M	89.2%	1.1M	94.0bp	95.8bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ016HA3	15.7M	15.0M	95.3%	13.9M	88.6%	1.1M	96.0bp	98.3bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ016HA4	13.7M	13.0M	94.8%	11.9M	87.1%	1.0M	91.0bp	93.8bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ016HA5	14.0M	13.0M	93.3%	11.8M	84.2%	1.3M	84.0bp	88.5bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ016HA6	12.4M	11.9M	95.8%	10.9M	87.7%	1.0M	94.0bp	96.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ016LA1	12.8M	11.9M	92.7%	10.9M	85.0%	1.0M	88.0bp	93.2bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.8%	0.0%	2.4bp	0.0%	2.0bp
RZZ016LA2	12.9M	12.4M	96.3%	11.7M	90.8%	0.7M	99.0bp	100.8bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ016LA3	16.7M	16.0M	95.6%	14.8M	88.6%	1.2M	98.0bp	100.2bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.1bp
RZZ016LA4	16.5M	15.8M	95.6%	14.9M	90.0%	0.9M	95.0bp	97.4bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ016LA5	14.2M	13.6M	96.1%	12.9M	90.7%	0.8M	100.0bp	101.7bp	1.6M	1.6M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ016LA6	13.9M	13.4M	96.4%	12.5M	89.8%	0.9M	99.0bp	100.6bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ017HA1	14.5M	13.8M	95.4%	12.7M	88.1%	1.1M	98.0bp	100.7bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ017HA2	19.2M	18.0M	93.6%	16.7M	86.8%	1.3M	91.0bp	94.8bp	1.6M	1.6M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.1bp
RZZ017HA3	15.3M	14.7M	95.6%	13.2M	86.3%	1.4M	94.0bp	97.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ017HA4	14.9M	14.1M	94.7%	12.9M	86.3%	1.2M	89.0bp	92.0bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ017HA5	13.3M	12.7M	96.1%	12.0M	90.4%	0.8M	101.0bp	102.9bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ017HA6	13.6M	13.0M	95.7%	11.8M	86.9%	1.2M	96.0bp	98.9bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ017LA1	14.2M	13.5M	95.5%	12.5M	88.0%	1.1M	97.0bp	99.4bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ017LA2	13.9M	13.4M	96.5%	12.6M	90.4%	0.8M	99.0bp	100.4bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ017LA3	14.6M	14.0M	96.0%	13.0M	89.5%	1.0M	97.0bp	99.2bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ017LA4	12.7M	12.1M	95.4%	11.4M	89.8%	0.7M	95.0bp	97.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ017LA5	14.2M	13.6M	96.3%	12.9M	91.0%	0.8M	102.0bp	104.0bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZZ017LA6	14.7M	14.3M	97.1%	13.7M	92.9%	0.6M	119.0bp	119.5bp	2.6M	2.6M	2.5M	0.0M	0.0M	0.0M	0.7%	0.1%	2.5bp	0.0%	2.1bp
RZZ018HA1	12.8M	12.2M	94.8%	11.2M	87.2%	1.0M	96.0bp	99.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ018HA2	14.9M	14.3M	96.0%	13.4M	90.4%	0.8M	97.0bp	98.5bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ018HA3	18.1M	17.3M	95.7%	16.1M	89.2%	1.2M	99.0bp	101.0bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.1bp
RZZ018HA4	15.6M	15.0M	96.1%	14.0M	89.6%	1.0M	99.0bp	100.1bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.1bp
RZZ018HA5	12.3M	11.8M	95.4%	10.9M	88.1%	0.9M	97.0bp	99.7bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ018HA6	17.9M	17.1M	95.8%	15.9M	89.1%	1.2M	97.0bp	99.1bp	1.8M	1.8M	1.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ018LA1	12.5M	12.0M	96.1%	11.2M	90.0%	0.8M	102.0bp	103.6bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ018LA2	19.4M	18.5M	95.3%	17.3M	89.1%	1.2M	89.0bp	92.0bp	1.6M	1.6M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ018LA3	12.2M	11.7M	95.7%	10.8M	88.9%	0.8M	99.0bp	101.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ018LA4	15.7M	15.0M	95.4%	13.7M	87.4%	1.3M	94.0bp	96.5bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ018LA5	12.2M	11.7M	96.1%	11.0M	90.4%	0.7M	102.0bp	103.4bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.1bp
RZZ018LA6	16.7M	16.0M	95.8%	14.9M	89.0%	1.1M	95.0bp	97.3bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ019HA1	10.7M	10.3M	95.8%	9.5M	88.4%	0.8M	100.0bp	102.9bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ019HA2	12.0M	11.5M	96.1%	10.8M	90.0%	0.7M	97.0bp	98.5bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ019HA3	13.4M	12.8M	95.7%	11.8M	88.3%	1.0M	96.0bp	98.1bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.8%	0.1%	2.4bp	0.0%	2.0bp
RZZ019HA4	14.3M	13.7M	95.9%	12.6M	88.3%	1.1M	97.0bp	99.1bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ019HA5	8.5M	8.1M	95.6%	7.5M	88.3%	0.6M	99.0bp	101.9bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ019HA6	13.2M	12.6M	95.8%	11.3M	86.1%	1.3M	95.0bp	97.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ019LA1	11.4M	10.6M	93.0%	9.7M	84.8%	0.9M	90.0bp	95.2bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.8%	0.0%	2.4bp	0.0%	2.0bp
RZZ019LA2	7.5M	7.2M	96.3%	6.7M	89.8%	0.5M	97.0bp	98.7bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ019LA3	13.1M	12.6M	95.6%	11.6M	88.5%	0.9M	98.0bp	100.4bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.8%	0.1%	2.4bp	0.0%	2.0bp
RZZ019LA4	18.4M	17.6M	95.5%	16.3M	88.6%	1.3M	94.0bp	97.0bp	1.8M	1.8M	1.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ019LA5	18.6M	17.8M	95.8%	16.7M	89.8%	1.1M	102.0bp	104.6bp	2.1M	2.1M	2.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ019LA6	9.4M	9.1M	96.2%	8.4M	89.2%	0.7M	97.0bp	99.1bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ035HA1	14.8M	14.2M	95.7%	13.1M	88.5%	1.1M	97.0bp	99.8bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ035HA2	12.5M	12.0M	96.1%	10.9M	86.9%	1.1M	97.0bp	99.2bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ035HA3	13.9M	13.3M	95.9%	12.4M	89.1%	0.9M	97.0bp	98.8bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ035HA4	11.2M	10.6M	94.5%	9.9M	87.6%	0.8M	93.0bp	96.6bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ035HA5	16.7M	16.0M	95.8%	14.7M	88.4%	1.2M	100.0bp	102.6bp	1.8M	1.8M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ035HA6	13.1M	12.6M	96.3%	11.7M	89.2%	0.9M	97.0bp	99.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ035LA1	12.7M	12.2M	95.6%	11.3M	89.1%	0.8M	99.0bp	101.1bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ035LA2	8.8M	8.5M	96.4%	8.0M	91.1%	0.5M	100.0bp	101.2bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZZ035LA3	17.7M	17.0M	95.7%	15.8M	89.2%	1.2M	98.0bp	100.3bp	1.8M	1.8M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.0bp
RZZ035LA4	13.6M	13.0M	95.6%	12.0M	88.1%	1.0M	93.0bp	95.1bp	1.2M	1.2M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ035LA5	15.2M	14.3M	94.4%	13.5M	88.7%	0.9M	94.0bp	97.6bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ035LA6	11.0M	10.5M	95.9%	9.8M	89.4%	0.7M	95.0bp	96.8bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074HA1	13.3M	12.7M	95.5%	11.7M	88.4%	0.9M	98.0bp	100.6bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ074HA2	16.0M	15.1M	94.7%	13.9M	86.9%	1.2M	91.0bp	94.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074HA3	10.2M	9.6M	94.3%	8.8M	86.7%	0.8M	94.0bp	98.4bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074HA4	16.0M	15.3M	95.7%	14.1M	88.4%	1.2M	92.0bp	94.0bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074HA5	14.9M	14.3M	95.9%	13.4M	90.0%	0.9M	100.0bp	102.0bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ074HA6	13.7M	13.1M	95.9%	12.0M	87.8%	1.1M	94.0bp	96.1bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074LA1	15.5M	14.8M	95.1%	13.7M	88.3%	1.1M	96.0bp	99.3bp	1.6M	1.6M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074LA2	15.9M	15.2M	95.6%	14.4M	90.5%	0.8M	98.0bp	99.6bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ074LA3	14.3M	13.7M	96.0%	12.7M	88.7%	1.0M	98.0bp	99.9bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ074LA4	12.9M	12.3M	95.0%	11.2M	86.4%	1.1M	91.0bp	94.4bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ074LA5	15.5M	14.9M	95.7%	14.0M	89.9%	0.9M	99.0bp	101.5bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZZ074LA6	1.0M	0.9M	96.8%	0.9M	91.3%	0.1M	123.0bp	124.1bp	0.3M	0.3M	0.3M	0.0M	0.0M	0.0M	0.6%	0.0%	2.4bp	0.0%	2.2bp
RZZ075HA1	13.6M	12.9M	94.9%	11.9M	87.3%	1.0M	94.0bp	97.5bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ075HA2	12.6M	12.2M	96.6%	11.5M	91.4%	0.7M	101.0bp	102.3bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ075HA3	12.4M	11.9M	95.9%	11.0M	88.5%	0.9M	98.0bp	100.2bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.0bp
RZZ075HA4	14.3M	13.6M	95.1%	12.8M	89.1%	0.9M	90.0bp	93.1bp	1.3M	1.3M	1.3M	0.1M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ075HA5	12.2M	11.7M	96.0%	11.0M	90.1%	0.7M	98.0bp	100.1bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ075HA6	13.2M	12.6M	95.5%	11.6M	88.0%	1.0M	92.0bp	95.0bp	1.2M	1.2M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ075LA1	12.1M	11.3M	93.3%	10.3M	85.0%	1.0M	89.0bp	94.1bp	1.1M	1.1M	1.0M	0.0M	0.0M	0.0M	0.8%	0.0%	2.4bp	0.0%	2.0bp
RZZ075LA2	8.0M	7.7M	96.3%	7.2M	90.2%	0.5M	99.0bp	100.3bp	0.8M	0.8M	0.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ075LA3	14.3M	13.8M	96.0%	12.9M	89.9%	0.9M	100.0bp	101.3bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.1bp
RZZ075LA4	12.3M	11.8M	95.8%	10.9M	88.5%	0.9M	97.0bp	99.4bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ075LA5	18.6M	17.6M	94.2%	16.5M	88.5%	1.1M	91.0bp	94.8bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ075LA6	11.7M	11.3M	96.4%	10.6M	91.2%	0.6M	98.0bp	100.2bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ076HA1	12.9M	12.4M	95.8%	11.5M	89.0%	0.9M	99.0bp	101.8bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ076HA2	14.3M	13.8M	96.4%	12.9M	90.0%	0.9M	96.0bp	97.6bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ076HA3	12.1M	11.6M	95.5%	10.6M	87.9%	0.9M	95.0bp	98.2bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ076HA4	15.5M	14.9M	96.4%	13.8M	89.4%	1.1M	94.0bp	96.1bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ076HA5	17.0M	16.3M	96.0%	15.4M	90.5%	0.9M	99.0bp	101.4bp	1.8M	1.8M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.1bp
RZZ076HA6	12.7M	12.2M	96.1%	11.2M	88.2%	1.0M	94.0bp	95.8bp	1.2M	1.2M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ076LA1	12.2M	11.6M	95.0%	10.7M	87.9%	0.9M	96.0bp	99.3bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.0bp
RZZ076LA2	11.4M	11.0M	96.0%	10.0M	87.4%	1.0M	96.0bp	98.9bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ076LA3	12.7M	12.2M	96.0%	11.2M	88.8%	0.9M	98.0bp	100.2bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ076LA4	14.0M	13.5M	96.1%	12.4M	88.7%	1.0M	96.0bp	98.0bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ076LA5	10.9M	9.8M	89.9%	8.7M	79.8%	1.1M	72.0bp	78.4bp	0.6M	0.6M	0.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	1.9bp
RZZ076LA6	15.9M	15.3M	95.7%	14.1M	88.5%	1.2M	95.0bp	97.1bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ996HA1	10.3M	9.5M	92.4%	8.8M	84.9%	0.8M	91.0bp	96.5bp	0.9M	0.9M	0.9M	0.0M	0.0M	0.0M	0.8%	0.1%	2.4bp	0.0%	2.0bp
RZZ996HA2	12.7M	12.2M	96.6%	11.6M	91.4%	0.7M	99.0bp	100.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ996HA3	11.1M	10.5M	95.3%	9.8M	88.7%	0.7M	93.0bp	96.3bp	1.0M	1.0M	1.0M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ996HA4	14.4M	13.8M	95.6%	12.7M	88.1%	1.1M	95.0bp	97.3bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ996HA5	16.2M	15.6M	96.2%	14.8M	91.1%	0.8M	102.0bp	103.4bp	1.8M	1.8M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ996HA6	14.0M	12.9M	91.9%	12.0M	85.2%	0.9M	88.0bp	92.8bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ996LA1	14.2M	13.7M	95.8%	12.8M	89.7%	0.9M	98.0bp	100.6bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ996LA2	13.7M	13.2M	96.2%	12.2M	89.0%	1.0M	98.0bp	100.0bp	1.5M	1.5M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ996LA3	12.5M	12.0M	95.5%	11.1M	88.6%	0.9M	96.0bp	98.3bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ996LA4	14.7M	14.0M	95.1%	12.9M	87.5%	1.1M	91.0bp	94.5bp	1.4M	1.4M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ996LA5	14.4M	13.7M	95.5%	12.9M	89.4%	0.9M	98.0bp	100.2bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ996LA6	18.7M	17.9M	95.6%	16.8M	89.8%	1.1M	93.0bp	95.3bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.0bp
RZZ997HA1	16.0M	15.3M	95.5%	14.1M	88.4%	1.1M	97.0bp	99.7bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.0bp
RZZ997HA2	14.2M	13.7M	96.4%	12.8M	90.3%	0.9M	97.0bp	98.4bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ997HA3	15.8M	15.2M	96.0%	14.1M	88.9%	1.1M	98.0bp	99.7bp	1.5M	1.5M	1.4M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ997HA4	18.7M	17.9M	95.6%	16.5M	88.3%	1.4M	94.0bp	96.2bp	1.7M	1.7M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ997HA5	18.6M	17.6M	94.7%	16.2M	87.1%	1.4M	95.0bp	98.4bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ997HA6	12.5M	12.0M	96.2%	11.0M	88.1%	1.0M	95.0bp	97.0bp	1.2M	1.2M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ997LA1	14.0M	13.5M	96.2%	12.6M	90.0%	0.9M	100.0bp	101.5bp	1.6M	1.6M	1.5M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.0bp
RZZ997LA2	16.2M	15.7M	96.6%	14.8M	91.1%	0.9M	101.0bp	102.1bp	1.8M	1.8M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ997LA3	12.0M	11.5M	95.5%	10.7M	88.5%	0.8M	96.0bp	98.4bp	1.2M	1.2M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ997LA4	14.1M	13.5M	95.8%	12.5M	88.9%	1.0M	95.0bp	97.7bp	1.3M	1.3M	1.3M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ997LA5	15.3M	14.6M	95.8%	13.7M	90.0%	0.9M	100.0bp	101.9bp	1.6M	1.6M	1.6M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZZ997LA6	7.7M	7.4M	96.2%	7.0M	89.8%	0.5M	97.0bp	98.3bp	0.7M	0.7M	0.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.3bp	0.0%	2.1bp
RZZ999ZA1	12.7M	12.0M	94.5%	11.3M	88.4%	0.8M	96.0bp	99.5bp	1.3M	1.3M	1.2M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ999ZA2	10.2M	9.9M	96.5%	9.3M	90.8%	0.6M	100.0bp	101.4bp	1.1M	1.1M	1.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp
RZZ999ZA3	14.2M	13.6M	95.5%	12.6M	88.4%	1.0M	98.0bp	100.6bp	1.4M	1.4M	1.3M	0.0M	0.0M	0.0M	0.7%	0.1%	2.4bp	0.0%	2.1bp
RZZ999ZA4	17.6M	16.9M	95.9%	15.7M	89.3%	1.2M	96.0bp	98.1bp	1.7M	1.7M	1.7M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.0bp
RZZ999ZA5	18.1M	17.4M	95.9%	16.3M	89.7%	1.1M	102.0bp	104.1bp	2.1M	2.1M	2.1M	0.0M	0.0M	0.0M	0.7%	0.0%	2.5bp	0.0%	2.1bp
RZZ999ZA6	18.5M	17.7M	95.7%	16.4M	88.4%	1.4M	95.0bp	97.3bp	1.8M	1.8M	1.8M	0.0M	0.0M	0.0M	0.7%	0.0%	2.4bp	0.0%	2.1bp

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: star_summary_table_table

Sort	Column	Description	ID	Scale
\|\|	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	Avg. read len	Average input read length	`star-avg_input_read_length`
\|\|	Avg. mapped len	Average mapped length	`star-avg_mapped_read_length`
\|\|	Splices	Number of splices: Total	`star-num_splices`	read_count
\|\|	Annotated splices	Number of splices: Annotated (sjdb)	`star-num_annotated_splices`	read_count
\|\|	GT/AG splices	Number of splices: GT/AG	`star-num_GTAG_splices`	read_count
\|\|	GC/AG splices	Number of splices: GC/AG	`star-num_GCAG_splices`	read_count
\|\|	AT/AC splices	Number of splices: AT/AC	`star-num_ATAC_splices`	read_count
\|\|	Non-canonical splices	Number of splices: Non-canonical	`star-num_noncanonical_splices`	read_count
\|\|	Mismatch rate	Mismatch rate per base	`star-mismatch_rate`
\|\|	Del rate	Deletion rate per base	`star-deletion_rate`
\|\|	Del len	Deletion average length	`star-deletion_length`
\|\|	Ins rate	Insertion rate per base	`star-insertion_rate`
\|\|	Ins len	Insertion average length	`star-insertion_length`

Alignment Scores

Created with MultiQC

UMI-tools

Tools for dealing with Unique Molecular Identifiers (UMIs)/(RMTs) and scRNA-Seq barcodes.https://github.com/CGATOxford/UMI-toolsDOI: 10.1101/gr.209601.116

Deduplicated Reads

Created with MultiQC

UMI Stats

Statistics from running umi_tools dedup or umi_tools extract

Positions Dedup: Total number of positions deduplicated
Total UMIs: Total UMIs found in sample
Unique UMIs: Unique UMIs found in sample
Mean #UMI: Mean number of unique UMIs per position
Max #UMI: Max number of unique UMIs per position

Created with MultiQC

Showing ¹⁹²/₁₉₂ rows and ⁵/₅ columns.

Sample Name	Positions Dedup	Total UMIs	Unique UMIs	Mean #UMI	Max #UMI
RZY000ZA1	1848299	22992404	6372	1.80	4204
RZY000ZA2	1653757	11212536	5535	1.77	4143
RZY000ZA3	1678905	12359527	5693	1.72	4128
RZY000ZA4	2155054	14564296	5878	1.75	4188
RZY000ZA5	2014885	11590948	5687	1.77	4136
RZY000ZA6	1828739	11809679	5685	1.73	4165
RZY019HA1	2095231	11636517	5637	1.77	4138
RZY019HA2	1861974	10554833	5550	1.79	4143
RZY019HA3	1977216	14514090	5888	1.75	4160
RZY019HA4	2467251	15256399	5914	1.75	4164
RZY019HA5	1983076	12492532	5747	1.77	4153
RZY019HA6	2026145	13262656	5780	1.70	4168
RZY019LA1	1423113	11549703	5593	1.85	4153
RZY019LA2	2439698	19221305	6154	1.73	4188
RZY019LA3	2281392	16027717	5916	1.71	4177
RZY019LA4	2062273	15052802	5922	1.71	4172
RZY019LA5	2029538	14990562	5911	1.77	4171
RZY019LA6	1987280	12619863	5790	1.77	4157
RZY996LA1	2208858	28499499	6608	1.81	4247
RZY996LA2	1422199	12460931	5623	1.76	4111
RZY996LA3	1928768	11423491	5642	1.76	4168
RZY996LA4	1919931	12801424	5645	1.71	4154
RZY996LA5	1933724	13964478	5784	1.81	4197
RZY996LA6	2029624	13798458	5857	1.73	4167
RZY996MA1	1571063	18606471	6043	1.71	4103
RZY996MA2	1977132	12721769	5733	1.77	4153
RZY996MA3	1838709	12373051	5718	1.79	4164
RZY996MA4	2023784	12990531	5728	1.75	4148
RZY996MA5	1853592	11899740	5666	1.72	4171
RZY996MA6	1750403	11989238	5634	1.71	4152
RZY999ZA1	2401978	31445557	6636	1.84	4244
RZY999ZA2	1367047	8537680	5327	1.75	4093
RZY999ZA3	1943536	13765545	5799	1.80	4177
RZY999ZA4	1955326	14028389	5762	1.70	4152
RZY999ZA5	1907026	11775192	5697	1.73	4166
RZY999ZA6	1794440	12417227	5747	1.71	4151
RZZ000ZA1	1746515	13930957	5509	1.93	4066
RZZ000ZA2	823900	9135734	5514	1.66	3982
RZZ000ZA3	2104219	16432026	5659	1.92	4121
RZZ000ZA4	2686961	20667095	6262	1.73	4134
RZZ000ZA5	3039465	23861097	6045	1.96	4179
RZZ000ZA6	2130924	17690682	6081	1.77	4175
RZZ014HA1	1697987	14779775	5609	1.89	4122
RZZ014HA2	1955179	16755343	6081	1.85	4202
RZZ014HA3	2447094	15584682	5575	1.93	4163
RZZ014HA4	2212655	19827588	6217	1.92	4188
RZZ014HA5	1934699	16471799	5688	1.87	4154
RZZ014HA6	2410686	19302838	6163	2.00	4205
RZZ014LA1	2372309	17866202	5716	1.89	4128
RZZ014LA2	2134065	17938339	6152	1.85	4216
RZZ014LA3	2070263	17926256	5769	1.92	4155
RZZ014LA4	1985273	16265678	5995	1.87	4166
RZZ014LA5	2588239	17644370	5798	1.96	4120
RZZ014LA6	1811907	13077576	5836	1.95	4121
RZZ015HA1	2268487	17356594	5725	1.93	4169
RZZ015HA2	2055811	12879025	5847	1.84	4162
RZZ015HA3	2613866	18572956	5795	1.92	4170
RZZ015HA4	1916707	16303860	6020	1.90	4194
RZZ015HA5	2403880	21570604	5921	1.97	4189
RZZ015HA6	2021900	18543126	6170	1.83	4199
RZZ015LA1	2608840	16974138	5745	1.85	4144
RZZ015LA2	2580863	16928111	6112	1.90	4196
RZZ015LA3	1735004	14952718	5602	1.86	4086
RZZ015LA4	2257115	17706896	6100	1.86	4190
RZZ015LA5	2974786	20674392	5826	1.91	4160
RZZ015LA6	2235181	18908148	6191	1.90	4191
RZZ016HA1	2030348	17763424	5749	1.92	4148
RZZ016HA2	2304414	19632980	6201	1.90	4240
RZZ016HA3	2083426	18612516	5769	1.88	4151
RZZ016HA4	2005745	16423737	6043	1.90	4204
RZZ016HA5	2673883	18049864	5642	1.92	4187
RZZ016HA6	1453749	14866748	5922	1.94	4163
RZZ016LA1	2828518	15485617	5624	1.78	4146
RZZ016LA2	2209353	14508230	5931	1.83	4174
RZZ016LA3	2391666	19762273	5817	1.87	4140
RZZ016LA4	2558361	19232825	6202	1.93	4194
RZZ016LA5	2045324	16153228	5700	1.91	4142
RZZ016LA6	2109824	16143794	6040	1.92	4152
RZZ017HA1	1849778	17199212	5663	1.92	4119
RZZ017HA2	2307132	22246366	6386	1.86	4206
RZZ017HA3	1984123	18782572	5718	1.91	4175
RZZ017HA4	2665020	18054746	6077	1.85	4194
RZZ017HA5	1660296	15198259	5661	1.88	4097
RZZ017HA6	1458338	16246419	5930	1.94	4102
RZZ017LA1	2160391	16985638	5635	1.88	4103
RZZ017LA2	2074994	15840018	6025	1.86	4186
RZZ017LA3	2141824	17188486	5732	1.94	4135
RZZ017LA4	2120016	14822103	5934	1.82	4141
RZZ017LA5	2069886	16042942	5708	1.91	4113
RZZ017LA6	1584981	16079515	6109	1.81	4088
RZZ018HA1	2269805	15552277	5623	1.92	4136
RZZ018HA2	2435905	16924397	6104	1.85	4186
RZZ018HA3	2576434	21176766	5873	1.89	4165
RZZ018HA4	2574957	18186803	6168	1.78	4160
RZZ018HA5	2506551	14855259	5539	1.93	4153
RZZ018HA6	2250868	20794653	6279	1.88	4196
RZZ018LA1	1773778	14359217	5566	1.87	4099
RZZ018LA2	3325595	23558425	6388	2.00	4232
RZZ018LA3	1546767	14362349	5612	1.89	4061
RZZ018LA4	2159467	18806411	6176	1.85	4163
RZZ018LA5	2059768	13930242	5593	1.89	4098
RZZ018LA6	2262786	19644137	6230	1.86	4172
RZZ019HA1	1624391	12861692	5445	1.87	4043
RZZ019HA2	1767891	13792788	5867	1.87	4170
RZZ019HA3	2835006	16105070	5597	1.91	4158
RZZ019HA4	1819037	16990090	6052	1.91	4167
RZZ019HA5	1383985	10133412	5274	1.88	4032
RZZ019HA6	2143702	16043587	5988	1.98	4169
RZZ019LA1	2455477	14142306	5504	1.81	4108
RZZ019LA2	1637679	8641740	5406	1.84	4128
RZZ019LA3	2470887	15774145	5574	1.90	4143
RZZ019LA4	2607099	21674017	6347	1.88	4220
RZZ019LA5	2713145	20909570	5851	1.90	4149
RZZ019LA6	2003918	10988357	5657	1.86	4133
RZZ035HA1	2171009	17632150	5722	1.91	4142
RZZ035HA2	2340457	15149776	5882	1.96	4167
RZZ035HA3	2321688	16550378	5669	1.92	4163
RZZ035HA4	1260900	13193238	5777	1.74	4038
RZZ035HA5	2270552	19132111	5823	1.88	4142
RZZ035HA6	2111872	15450617	5936	1.87	4149
RZZ035LA1	2036968	14962427	5607	1.86	4111
RZZ035LA2	1787662	9857907	5569	1.84	4140
RZZ035LA3	1968560	20735821	5851	1.94	4145
RZZ035LA4	2203990	16165802	5960	1.80	4163
RZZ035LA5	3054013	17328628	5703	1.88	4178
RZZ035LA6	2083441	12844481	5762	1.91	4151
RZZ074HA1	2176361	15811485	5591	1.94	4134
RZZ074HA2	2702872	19197295	6160	1.85	4216
RZZ074HA3	1228844	12433266	5377	1.78	3877
RZZ074HA4	2157456	18953443	6111	1.82	4207
RZZ074HA5	2595219	17087936	5763	1.92	4134
RZZ074HA6	2213498	16409297	5986	1.91	4176
RZZ074LA1	1898045	18516610	5739	1.88	4111
RZZ074LA2	1890878	18086139	6170	1.85	4191
RZZ074LA3	2690193	17159003	5697	2.00	4175
RZZ074LA4	2213967	15964923	5950	1.95	4167
RZZ074LA5	1881501	17810995	5766	1.87	4102
RZZ074LA6	331456	1049411	4363	1.65	2631
RZZ075HA1	2470776	16460896	5635	1.92	4146
RZZ075HA2	1929027	14174381	5975	1.90	4173
RZZ075HA3	1656379	14776083	5575	1.91	4096
RZZ075HA4	1979860	16972571	6044	1.85	4178
RZZ075HA5	1834372	14057944	5535	1.92	4127
RZZ075HA6	2364345	15689231	5942	1.91	4179
RZZ075LA1	2698477	14973728	5524	1.90	4134
RZZ075LA2	1747980	9240159	5453	1.88	4143
RZZ075LA3	2307628	16594389	5677	1.89	4129
RZZ075LA4	2093552	14584903	5941	1.92	4150
RZZ075LA5	3122087	21177955	5932	1.91	4171
RZZ075LA6	1673784	13557951	5899	1.97	4145
RZZ076HA1	2060823	15231595	5599	1.95	4117
RZZ076HA2	2018079	16409531	6056	1.99	4208
RZZ076HA3	2010328	14581533	5535	2.03	4141
RZZ076HA4	1562838	17997785	6108	1.96	4197
RZZ076HA5	2548883	19108177	5864	2.02	4168
RZZ076HA6	1889312	15289597	5977	2.08	4199
RZZ076LA1	2014849	14379777	5557	1.85	4135
RZZ076LA2	2244744	13561691	5826	1.97	4154
RZZ076LA3	2099581	14856909	5582	2.00	4140
RZZ076LA4	1967231	16606081	6042	1.92	4156
RZZ076LA5	2720613	14403631	5405	1.88	4142
RZZ076LA6	2521387	18899939	6202	1.91	4191
RZZ996HA1	2259770	12283447	5455	1.76	4098
RZZ996HA2	2297698	14187786	5983	1.86	4174
RZZ996HA3	1855530	13807089	5490	1.93	4105
RZZ996HA4	2105775	17288192	6049	1.89	4160
RZZ996HA5	2186049	18244438	5732	1.90	4130
RZZ996HA6	2376387	16838148	6037	1.83	4156
RZZ996LA1	2148546	16689427	5673	1.89	4124
RZZ996LA2	1892620	16265914	6013	1.95	4127
RZZ996LA3	2210622	14942332	5549	1.87	4156
RZZ996LA4	2709249	17800271	6095	1.92	4186
RZZ996LA5	2122716	16730078	5673	1.85	4131
RZZ996LA6	1934685	22253998	6410	1.82	4155
RZZ997HA1	2323506	19007664	5825	1.90	4136
RZZ997HA2	2312123	16250426	6087	1.88	4172
RZZ997HA3	2313430	18661602	5805	1.96	4159
RZZ997HA4	2529588	21902275	6360	1.89	4239
RZZ997HA5	3131760	21807721	5917	1.95	4182
RZZ997HA6	1846298	14882640	5917	1.99	4178
RZZ997LA1	1963456	16264923	5741	1.89	4156
RZZ997LA2	2503082	18058323	6216	1.90	4212
RZZ997LA3	1991100	14370160	5517	1.82	4126
RZZ997LA4	2314386	16591793	5993	1.88	4180
RZZ997LA5	2203166	17603580	5718	1.92	4153
RZZ997LA6	1696206	9004409	5473	1.80	4123
RZZ999ZA1	2232119	15010963	5589	1.84	4092
RZZ999ZA2	1973536	11530478	5714	1.86	4143
RZZ999ZA3	1900086	16893826	5665	1.88	4080
RZZ999ZA4	2443595	20557963	6262	1.90	4212
RZZ999ZA5	2610621	20486527	5907	1.96	4180
RZZ999ZA6	2573304	22015713	6335	1.92	4198

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: umitools_stats_violin_table

Sort	Column	Description	ID
\|\|	Positions Dedup	Total number of positions deduplicated	`positions_deduplicated`
\|\|	Total UMIs	Total UMIs found in sample	`total_umis`
\|\|	Unique UMIs	Unique UMIs found in sample	`unique_umis`
\|\|	Mean #UMI	Mean number of unique UMIs per position	`mean_umi_per_pos`
\|\|	Max #UMI	Max number of unique UMIs per position	`max_umi_per_pos`

Sample relationships

Plots interrogating sample relationships, based on final count matrices.

STAR_SALMON DESeq2 sample similarity

is generated from clustering by Euclidean distances between DESeq2 rlog values for each sample in the deseq2_qc.r script.

Created with MultiQC

STAR_SALMON DESeq2 PCA plot

PCA plot between samples in the experiment. These values are calculated using DESeq2 in the deseq2_qc.r script.

Created with MultiQC

SortMeRNA

Program for filtering, mapping and OTU-picking NGS reads in metatranscriptomic and metagenomic data.http://bioinfo.lifl.fr/RNA/sortmernaDOI: 10.1093/bioinformatics/bts611

The core algorithm is based on approximate seeds and allows for fast and sensitive analyses of nucleotide sequences. The main application of SortMeRNA is filtering ribosomal RNA from metatranscriptomic data.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
CAT_FASTQ	cat	`9.5`
CUSTOM_GETCHROMSIZES	getchromsizes	`1.21`
CUSTOM_TX2GENE	python	`3.10.4`
DESEQ2_QC_STAR_SALMON	bioconductor-deseq2	`1.46.0`
	r-base	`4.4.2`
FASTQC_RAW	fastqc	`0.12.1`
FASTQC_TRIM	fastqc	`0.12.1`
FQ_LINT	fq	`0.12.0 (2024-07-08)`
FQ_SUBSAMPLE	fq	`0.12.0 (2024-07-08)`
GTF2BED	perl	`5.26.2`
GTF_FILTER	python	`3.9.5`
MAKE_TRANSCRIPTS_FASTA	rsem	`1.3.1`
	star	`2.7.10a`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
QUALIMAP_RNASEQ	qualimap	`2.3`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SALMON_INDEX	salmon	`1.10.3`
SALMON_QUANT	salmon	`1.10.3`
SAMTOOLS_FLAGSTAT	samtools	`1.21`
SAMTOOLS_IDXSTATS	samtools	`1.21`
SAMTOOLS_INDEX	samtools	`1.21`
SAMTOOLS_SORT	samtools	`1.21`
SAMTOOLS_SORT_QUALIMAP	samtools	`1.21`
SAMTOOLS_STATS	samtools	`1.21`
SE_GENE_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SE_TRANSCRIPT_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SORTMERNA_INDEX	sortmerna	`4.3.7`
STAR_ALIGN	gawk	`5.1.0`
	samtools	`1.21`
	star	`2.7.11b`
STAR_GENOMEGENERATE	gawk	`5.1.0`
	samtools	`1.21`
	star	`2.7.11b`
SortMeRNA	sortmerna	`4.3.7`
TXIMETA_TXIMPORT	bioconductor-tximeta	`1.20.1`
UMITOOLS_DEDUP	umitools	`1.1.5`
UMITOOLS_EXTRACT	umitools	`1.1.5`
Workflow	Nextflow	`25.04.7`
	nf-core/rnaseq	`v3.22.2-g3816d48`
fastp	fastp	`0.24.0`

nf-core/rnaseq Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.https://github.com/nf-core/rnaseq

Methods

Data was processed using nf-core/rnaseq v3.22.2 (doi: 10.5281/zenodo.1400710) of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.04.7 (Di Tommaso et al., 2017) with the following command:

nextflow run nf-core/rnaseq -r 3.22.2 -c ../rnaseq.config -params-file ../params_rnaseq.json -resume -profile crg_slurm

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnaseq Workflow Summary

this information is collected when the pipeline is started.https://github.com/nf-core/rnaseq

Input/output options

input: ../samplesheet_Danio.csv
multiqc_title: PTox-WP6-Danio
outdir: ./rnaseq_output

Reference genome options

fasta: ../refs/Danio/genome_with_spikes.fa
gtf: ../refs/Danio/genome_annotation_with_spikes.gtf

Read trimming options

extra_fastp_args: --length_required=20 --trim_poly_g --poly_g_min_len=20 --trim_poly_x --poly_x_min_len=15 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --dont_eval_duplication --cut_tail
trimmer: fastp

Read filtering options

remove_ribo_rna: true

UMI options

umi_discard_read: 0
umitools_bc_pattern: ^(?P.{6})(?P.{4}).*
umitools_dedup_stats: true
umitools_extract_method: regex
with_umi: true

Alignment options

extra_salmon_quant_args: --noLengthCorrection
extra_star_align_args: --alignIntronMax 1000000 --alignIntronMin 20 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --outFilterMismatchNmax 999 --outFilterMultimapNmax 20 --outFilterType BySJout --outFilterMismatchNoverLmax 0.1 --clip3pAdapterSeq AAAAAAAA
stranded_threshold: 0.7

Optional outputs

save_reference: true

Process skipping options

skip_bigwig: true
skip_biotype_qc: true
skip_dupradar: true
skip_preseq: false
skip_pseudo_alignment: true
skip_stringtie: true

Generic options

monochrome_logs: true
trace_report_suffix: 2026-06-09_12-00-28

Core Nextflow options

configFiles: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq/nextflow.config, /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-Danio/../rnaseq.config
containerEngine: apptainer
launchDir: /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-Danio
profile: crg_slurm
projectDir: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq
revision: 3.22.2
runName: compassionate_austin
userName: vntasis
workDir: /users/project/precisiontox_008279_no_backup/wp6_data/rnaseq_run-Danio/work

PTox-WP6-Danio

MultiQC Toolbox

Apply Highlight Samples

Rename Samples Bulk input Apply

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots All None

Save Settings

Load Settings

Tool Citations

About MultiQC

PTox-WP6-Danio

Report AI Summary

General Statistics

AI Summary

General Statistics: Columns

Sample status checks

Strandedness Checks

AI Summary

Samples strandedness check: Columns

FastQC (raw)

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Overrepresented sequences by sample Help

AI Summary

Top overrepresented sequences

AI Summary

FastQC: Top overrepresented sequences: Columns

AI Summary

Status Checks Help

AI Summary

fastp

Filtered Reads

AI Summary

Sequence Quality

AI Summary

GC Content

AI Summary

N content

AI Summary

FastQC (trimmed)

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Overrepresented sequences by sample Help

AI Summary

Top overrepresented sequences

AI Summary

FastQC: Top overrepresented sequences: Columns

AI Summary

Status Checks Help

AI Summary

Preseq

Complexity curve (molecule count)

AI Summary

QualiMap

Genomic origin of reads Help

AI Summary

Gene Coverage Profile Help

AI Summary

RSeQC

Read Distribution

Highlight Samples

Rename Samples

Show / Hide Samples

Choose Plots

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks

Genomic origin of reads

Gene Coverage Profile

Percent mapped

UMI Stats