PTox-Production-phase2-Drosophila-include-dups: MultiQC Report

General Statistics

Showing ⁴⁸/₄₈ rows and ¹⁰/₁₉ columns.

Sample Name	dupInt	Duplication	5'-3' bias	M Aligned	Exonic	Intronic	Intergenic	Overlapping Exon	Error rate	Non-primary	Reads mapped	% Mapped	% Proper pairs	% MapQ 0 reads	Total seqs	Mean insert	Reads	Reads mapped	% Reads mapped
FAH000ZA1	0.4	82.8%	0.43	4.5M	3.5M	0.3M	0.2M	0.6M	0.72%	1.3M	4.5M	100.0%	0.0%	2.0%	4.5M	0.0bp	5.8M	5.8M	100.0%
FAH000ZA2	0.5	83.0%	0.46	4.5M	3.5M	0.4M	0.2M	0.6M	0.72%	1.2M	4.5M	100.0%	0.0%	1.9%	4.5M	0.0bp	5.7M	5.7M	100.0%
FAH000ZA3	0.7	87.2%	0.39	5.4M	4.2M	0.4M	0.3M	0.7M	0.74%	1.5M	5.4M	100.0%	0.0%	2.2%	5.4M	0.0bp	6.8M	6.8M	100.0%
FAH000ZA4	0.5	84.2%	0.44	4.6M	3.6M	0.4M	0.2M	0.6M	0.70%	1.5M	4.6M	100.0%	0.0%	2.4%	4.6M	0.0bp	6.1M	6.1M	100.0%
FAH000ZA5	0.8	88.1%	0.42	6.0M	4.5M	0.6M	0.3M	0.8M	0.70%	1.8M	6.0M	100.0%	0.0%	2.9%	6.0M	0.0bp	7.8M	7.8M	100.0%
FAH000ZA6	0.5	83.4%	0.44	5.1M	3.9M	0.4M	0.3M	0.7M	0.71%	1.6M	5.1M	100.0%	0.0%	2.4%	5.1M	0.0bp	6.7M	6.7M	100.0%
FAH000ZA7	0.7	86.3%	0.46	5.5M	4.2M	0.5M	0.3M	0.8M	0.67%	1.4M	5.5M	100.0%	0.0%	2.4%	5.5M	0.0bp	6.9M	6.9M	100.0%
FAH000ZA8	0.4	81.0%	0.41	4.4M	3.5M	0.4M	0.2M	0.6M	0.71%	1.1M	4.4M	100.0%	0.0%	1.6%	4.4M	0.0bp	5.5M	5.5M	100.0%
FAH000ZB1	0.5	83.9%	0.41	5.7M	4.4M	0.5M	0.3M	0.8M	0.68%	1.3M	5.7M	100.0%	0.0%	1.7%	5.7M	0.0bp	7.0M	7.0M	100.0%
FAH000ZB2	0.5	85.1%	0.40	6.6M	5.0M	0.5M	0.3M	0.9M	0.70%	2.0M	6.6M	100.0%	0.0%	2.4%	6.6M	0.0bp	8.6M	8.6M	100.0%
FAH000ZB3	0.8	88.1%	0.45	6.6M	5.1M	0.5M	0.3M	0.9M	0.73%	2.0M	6.6M	100.0%	0.0%	2.2%	6.6M	0.0bp	8.5M	8.5M	100.0%
FAH000ZB4	0.5	81.9%	0.46	4.2M	3.2M	0.3M	0.2M	0.5M	0.73%	1.2M	4.2M	100.0%	0.0%	2.3%	4.2M	0.0bp	5.4M	5.4M	100.0%
FAH000ZB5	0.6	85.3%	0.38	5.8M	4.4M	0.5M	0.3M	0.7M	0.70%	1.9M	5.8M	100.0%	0.0%	2.7%	5.8M	0.0bp	7.7M	7.7M	100.0%
FAH000ZB6	0.4	79.8%	0.40	3.5M	2.7M	0.3M	0.2M	0.5M	0.73%	0.9M	3.5M	100.0%	0.0%	2.0%	3.5M	0.0bp	4.5M	4.5M	100.0%
FAH000ZB7	0.6	85.4%	0.43	5.4M	4.3M	0.4M	0.3M	0.7M	0.70%	1.4M	5.4M	100.0%	0.0%	1.8%	5.4M	0.0bp	6.8M	6.8M	100.0%
FAH000ZB8	0.3	79.7%	0.38	4.2M	3.2M	0.3M	0.2M	0.5M	0.72%	1.3M	4.2M	100.0%	0.0%	2.4%	4.2M	0.0bp	5.5M	5.5M	100.0%
FAH007LA1	0.7	86.2%	0.39	5.6M	4.3M	0.5M	0.3M	0.8M	0.68%	1.7M	5.6M	100.0%	0.0%	2.8%	5.6M	0.0bp	7.4M	7.4M	100.0%
FAH007LA2	0.5	82.6%	0.43	4.6M	3.6M	0.4M	0.2M	0.6M	0.71%	1.0M	4.6M	100.0%	0.0%	1.5%	4.6M	0.0bp	5.6M	5.6M	100.0%
FAH007LA3	0.7	86.5%	0.45	5.8M	4.4M	0.5M	0.3M	0.8M	0.70%	1.5M	5.8M	100.0%	0.0%	2.1%	5.8M	0.0bp	7.3M	7.3M	100.0%
FAH007LA4	0.5	82.7%	0.43	4.4M	3.4M	0.4M	0.2M	0.6M	0.75%	1.1M	4.4M	100.0%	0.0%	1.9%	4.4M	0.0bp	5.5M	5.5M	100.0%
FAH007LB1	0.5	84.0%	0.45	5.0M	3.9M	0.4M	0.2M	0.7M	0.71%	1.2M	5.0M	100.0%	0.0%	1.8%	5.0M	0.0bp	6.3M	6.3M	100.0%
FAH007LB2	0.6	85.7%	0.40	6.1M	4.7M	0.5M	0.3M	0.8M	0.69%	1.4M	6.1M	100.0%	0.0%	1.7%	6.1M	0.0bp	7.5M	7.5M	100.0%
FAH007LB3	0.6	83.4%	0.41	4.6M	3.5M	0.4M	0.2M	0.6M	0.71%	1.2M	4.6M	100.0%	0.0%	2.0%	4.6M	0.0bp	5.7M	5.7M	100.0%
FAH007LB4	0.5	85.2%	0.41	6.2M	4.8M	0.5M	0.3M	0.8M	0.74%	1.7M	6.2M	100.0%	0.0%	2.1%	6.2M	0.0bp	7.9M	7.9M	100.0%
FAI000ZA1	0.6	85.3%	0.41	6.0M	4.6M	0.5M	0.3M	0.7M	0.73%	1.7M	6.0M	100.0%	0.0%	2.0%	6.0M	0.0bp	7.6M	7.6M	100.0%
FAI000ZA2	0.4	79.4%	0.33	3.4M	2.6M	0.3M	0.2M	0.4M	0.74%	1.0M	3.4M	100.0%	0.0%	2.2%	3.4M	0.0bp	4.4M	4.4M	100.0%
FAI000ZA3	0.6	86.7%	0.38	8.5M	6.6M	0.7M	0.4M	1.1M	0.74%	2.4M	8.5M	100.0%	0.0%	2.0%	8.5M	0.0bp	10.9M	10.9M	100.0%
FAI000ZA4	0.5	82.5%	0.44	4.0M	3.0M	0.4M	0.2M	0.5M	0.72%	1.3M	4.0M	100.0%	0.0%	2.6%	4.0M	0.0bp	5.2M	5.2M	100.0%
FAI000ZA5	0.5	83.6%	0.39	4.2M	3.2M	0.4M	0.2M	0.5M	0.81%	1.4M	4.2M	100.0%	0.0%	2.9%	4.2M	0.0bp	5.7M	5.7M	100.0%
FAI000ZA6	0.5	84.7%	0.39	6.2M	4.9M	0.5M	0.3M	0.7M	0.78%	1.7M	6.2M	100.0%	0.0%	2.1%	6.2M	0.0bp	7.9M	7.9M	100.0%
FAI000ZA7	0.7	85.7%	0.36	4.6M	3.7M	0.3M	0.2M	0.6M	0.81%	1.2M	4.6M	100.0%	0.0%	2.0%	4.6M	0.0bp	5.9M	5.9M	100.0%
FAI000ZA8	0.5	86.7%	0.40	8.6M	6.7M	0.7M	0.4M	1.1M	0.74%	2.4M	8.6M	100.0%	0.0%	2.0%	8.6M	0.0bp	11.1M	11.1M	100.0%
FAI000ZB1	0.7	86.5%	0.33	5.5M	4.3M	0.4M	0.3M	0.7M	0.72%	1.6M	5.5M	100.0%	0.0%	2.1%	5.5M	0.0bp	7.1M	7.1M	100.0%
FAI000ZB2	0.5	83.5%	0.33	4.9M	3.8M	0.4M	0.3M	0.6M	0.76%	1.9M	4.9M	100.0%	0.0%	3.6%	4.9M	0.0bp	6.9M	6.9M	100.0%
FAI000ZB3	0.5	83.6%	0.47	4.2M	3.2M	0.3M	0.2M	0.5M	0.71%	1.3M	4.2M	100.0%	0.0%	2.6%	4.2M	0.0bp	5.5M	5.5M	100.0%
FAI000ZB4	0.5	85.5%	0.43	6.1M	4.7M	0.4M	0.3M	0.7M	0.75%	1.7M	6.1M	100.0%	0.0%	2.2%	6.1M	0.0bp	7.8M	7.8M	100.0%
FAI000ZB5	0.6	84.8%	0.36	4.6M	3.5M	0.4M	0.2M	0.5M	0.74%	1.5M	4.6M	100.0%	0.0%	2.5%	4.6M	0.0bp	6.0M	6.0M	100.0%
FAI000ZB6	0.6	85.9%	0.36	5.9M	4.7M	0.4M	0.3M	0.7M	0.77%	1.5M	5.9M	100.0%	0.0%	1.8%	5.9M	0.0bp	7.4M	7.4M	100.0%
FAI000ZB7	0.6	84.0%	0.37	4.8M	3.6M	0.4M	0.2M	0.6M	0.72%	1.6M	4.8M	100.0%	0.0%	2.7%	4.8M	0.0bp	6.4M	6.4M	100.0%
FAI000ZB8	0.8	86.6%	0.31	4.2M	3.3M	0.3M	0.2M	0.5M	0.78%	1.2M	4.2M	100.0%	0.0%	2.2%	4.2M	0.0bp	5.4M	5.4M	100.0%
FAI078AA1	0.5	84.5%	0.40	5.1M	4.0M	0.4M	0.2M	0.6M	0.75%	1.4M	5.1M	100.0%	0.0%	2.0%	5.1M	0.0bp	6.5M	6.5M	100.0%
FAI078AA2	0.6	87.6%	0.42	7.5M	5.8M	0.6M	0.4M	0.9M	0.73%	2.0M	7.5M	100.0%	0.0%	1.9%	7.5M	0.0bp	9.5M	9.5M	100.0%
FAI078AA3	0.5	79.9%	0.47	2.4M	1.9M	0.2M	0.1M	0.3M	0.73%	0.7M	2.4M	100.0%	0.0%	2.2%	2.4M	0.0bp	3.1M	3.1M	100.0%
FAI078AA4	0.4	77.9%	0.42	2.9M	2.2M	0.2M	0.1M	0.4M	0.72%	0.7M	2.9M	100.0%	0.0%	1.9%	2.9M	0.0bp	3.6M	3.6M	100.0%
FAI078AB1	0.5	83.4%	0.43	4.8M	3.8M	0.4M	0.2M	0.6M	0.74%	1.0M	4.8M	100.0%	0.0%	1.4%	4.8M	0.0bp	5.7M	5.7M	100.0%
FAI078AB2	0.5	82.5%	0.44	3.8M	3.0M	0.3M	0.2M	0.5M	0.74%	1.1M	3.8M	100.0%	0.0%	2.1%	3.8M	0.0bp	4.9M	4.9M	100.0%
FAI078AB3	0.6	87.1%	0.39	7.2M	5.6M	0.5M	0.3M	0.9M	0.74%	1.9M	7.2M	100.0%	0.0%	1.9%	7.2M	0.0bp	9.1M	9.1M	100.0%
FAI078AB4	0.4	80.4%	0.46	3.3M	2.6M	0.2M	0.2M	0.4M	0.75%	0.9M	3.3M	100.0%	0.0%	2.1%	3.3M	0.0bp	4.2M	4.2M	100.0%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: DupRadar	dupInt	Intercept value from DupRadar	`custom_content_dupradar-dupRadar_intercept`
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`picard_mark_duplicates-PERCENT_DUPLICATION`
\|\|	QualiMap: RNASeq	5'-3' bias	5'-3' bias	`qualimap_rnaseq-5_3_bias`
\|\|	QualiMap: RNASeq	M Aligned	Reads Aligned (millions)	`qualimap_rnaseq-reads_aligned`	read_count
\|\|	QualiMap: RNASeq	Exonic	Reads aligned to exonic regions	`qualimap_rnaseq-reads_aligned_exonic`	read_count
\|\|	QualiMap: RNASeq	Intronic	Reads aligned to intronic regions	`qualimap_rnaseq-reads_aligned_intronic`	read_count
\|\|	QualiMap: RNASeq	Intergenic	Reads aligned to intergenic regions	`qualimap_rnaseq-reads_aligned_intergenic`	read_count
\|\|	QualiMap: RNASeq	Overlapping Exon	Reads aligned to overlapping exon regions	`qualimap_rnaseq-reads_aligned_overlapping_exon`	read_count
\|\|	Samtools: stats	Error rate	Error rate: mismatches (NM) / bases mapped (CIGAR)	`samtools_stats-error_rate`
\|\|	Samtools: stats	Non-primary	Non-primary alignments (millions)	`samtools_stats-non_primary_alignments`	read_count
\|\|	Samtools: stats	Reads mapped	Reads mapped in the bam file (millions)	`samtools_stats-reads_mapped`	read_count
\|\|	Samtools: stats	% Mapped	% Mapped reads	`samtools_stats-reads_mapped_percent`
\|\|	Samtools: stats	% Proper pairs	% Properly paired reads	`samtools_stats-reads_properly_paired_percent`
\|\|	Samtools: stats	% MapQ 0 reads	% of reads that are ambiguously placed (MapQ=0)	`samtools_stats-reads_MQ0_percent`
\|\|	Samtools: stats	Total seqs	Total sequences in the bam file (millions)	`samtools_stats-raw_total_sequences`	read_count
\|\|	Samtools: stats	Mean insert	Average insert size	`samtools_stats-insert_size_average`
\|\|	Samtools: flagstat	Reads	Total reads in the bam file (millions)	`samtools_flagstat-flagstat_total`	read_count
\|\|	Samtools: flagstat	Reads mapped	Reads mapped in the bam file (millions)	`samtools_flagstat-mapped_passed`	read_count
\|\|	Samtools: flagstat	% Reads mapped	% Reads mapped in the bam file	`samtools_flagstat-mapped_passed_pct`

Sample status checks

Reports on sample strandedness status, and any failures in trimming or mapping.

Strandedness Checks

The strandedness used for analysis in this workflow can either be provided by the user or automatically inferred by Salmon using a sample of reads. In both cases, strandedness is verified at the end of the workflow using RSeQC's infer_experiment.py on genomic alignments. In this table, a pass indicates a match between the supplied strandedness (or that inferred by Salmon) and RSeQC results. A fail indicates a mismatch or 'undetermined' strandedness. 'Undetermined' strandedness can signal QC issues, including potential genomic DNA contamination.

Note: Rows are duplicated for an 'auto' setting to allow comparison of statistics between inference methods.

Showing ⁴⁸/₄₈ rows and ⁷/₇ columns.

Sample	Status	Strand inference method	Provided strandedness	Inferred strandedness	Sense (%)	Antisense (%)	Unstranded (%)
FAH000ZA1	fail	RSeQC	auto	forward	86.5	1.6	11.9
FAH000ZA2	fail	RSeQC	auto	forward	86.3	1.7	11.9
FAH000ZA3	fail	RSeQC	auto	forward	85.4	1.8	12.8
FAH000ZA4	fail	RSeQC	auto	forward	86.0	1.8	12.2
FAH000ZA5	fail	RSeQC	auto	forward	85.6	2.0	12.4
FAH000ZA6	fail	RSeQC	auto	forward	86.1	1.8	12.1
FAH000ZA7	fail	RSeQC	auto	forward	86.6	1.8	11.6
FAH000ZA8	fail	RSeQC	auto	forward	86.4	1.6	12.0
FAH000ZB1	fail	RSeQC	auto	forward	85.7	1.9	12.3
FAH000ZB2	fail	RSeQC	auto	forward	85.6	2.1	12.2
FAH000ZB3	fail	RSeQC	auto	forward	85.9	1.8	12.3
FAH000ZB4	fail	RSeQC	auto	forward	86.0	1.8	12.2
FAH000ZB5	fail	RSeQC	auto	forward	85.7	2.2	12.1
FAH000ZB6	fail	RSeQC	auto	forward	86.3	1.7	11.9
FAH000ZB7	fail	RSeQC	auto	forward	85.8	1.9	12.3
FAH000ZB8	fail	RSeQC	auto	forward	85.5	2.0	12.4
FAH007LA1	fail	RSeQC	auto	forward	86.4	2.0	11.6
FAH007LA2	fail	RSeQC	auto	forward	86.3	1.6	12.1
FAH007LA3	fail	RSeQC	auto	forward	86.2	1.8	12.0
FAH007LA4	fail	RSeQC	auto	forward	86.1	2.0	11.9
FAH007LB1	fail	RSeQC	auto	forward	86.4	1.6	12.0
FAH007LB2	fail	RSeQC	auto	forward	86.3	1.9	11.8
FAH007LB3	fail	RSeQC	auto	forward	86.9	1.8	11.3
FAH007LB4	fail	RSeQC	auto	forward	86.2	2.0	11.8
FAI000ZA1	fail	RSeQC	auto	forward	86.6	1.7	11.7
FAI000ZA2	fail	RSeQC	auto	forward	86.7	1.5	11.8
FAI000ZA3	fail	RSeQC	auto	forward	86.3	1.9	11.7
FAI000ZA4	fail	RSeQC	auto	forward	86.5	1.7	11.8
FAI000ZA5	fail	RSeQC	auto	forward	85.9	1.9	12.1
FAI000ZA6	fail	RSeQC	auto	forward	86.6	1.8	11.5
FAI000ZA7	fail	RSeQC	auto	forward	86.3	1.5	12.2
FAI000ZA8	fail	RSeQC	auto	forward	86.3	1.9	11.8
FAI000ZB1	fail	RSeQC	auto	forward	86.4	1.5	12.0
FAI000ZB2	fail	RSeQC	auto	forward	85.8	2.2	12.0
FAI000ZB3	fail	RSeQC	auto	forward	86.0	1.7	12.3
FAI000ZB4	fail	RSeQC	auto	forward	85.9	1.9	12.2
FAI000ZB5	fail	RSeQC	auto	forward	86.2	1.7	12.2
FAI000ZB6	fail	RSeQC	auto	forward	86.0	1.6	12.3
FAI000ZB7	fail	RSeQC	auto	forward	86.5	1.7	11.8
FAI000ZB8	fail	RSeQC	auto	forward	86.4	1.6	12.0
FAI078AA1	fail	RSeQC	auto	forward	86.6	1.7	11.7
FAI078AA2	fail	RSeQC	auto	forward	86.3	1.8	12.0
FAI078AA3	fail	RSeQC	auto	forward	86.4	1.5	12.1
FAI078AA4	fail	RSeQC	auto	forward	86.7	1.4	11.9
FAI078AB1	fail	RSeQC	auto	forward	86.4	1.5	12.1
FAI078AB2	fail	RSeQC	auto	forward	86.2	1.5	12.3
FAI078AB3	fail	RSeQC	auto	forward	86.0	1.8	12.2
FAI078AB4	fail	RSeQC	auto	forward	86.2	1.5	12.3

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fail_strand_check_table_table

Sort	Column	Description	ID
\|\|	Status	Pass if the strandedness inferred by RSeQC matches that provided by the user or predicted by Salmon. Fail otherwise.	`samples_strandedness_check-Status`
\|\|	Strand inference method	Tool used to detect strandedness	`samples_strandedness_check-Strand_inference_method`
\|\|	Provided strandedness	User-provided strandedness	`samples_strandedness_check-Provided_strandedness`
\|\|	Inferred strandedness	Interred strandedness	`samples_strandedness_check-Inferred_strandedness`
\|\|	Sense (%)	Sense (%)	`samples_strandedness_check-Sense`
\|\|	Antisense (%)	Antisense (%)	`samples_strandedness_check-Antisense`
\|\|	Unstranded (%)	Unstranded (%)	`samples_strandedness_check-Unstranded`

DupRadar

DupRadar provides duplication rate quality control for RNA-Seq datasets. Highly expressed genes can be expected to have a lot of duplicate reads, but high numbers of duplicates at low read counts can indicate low library complexity with technical duplication. This plot shows the general linear models - a summary of the gene duplication distributions.bioconductor.org/packages/release/bioc/html/dupRadar.html

Created with MultiQC

Picard

Tools for manipulating high-throughput sequencing data.http://broadinstitute.github.io/picard

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Estimates library complexity, showing how many additional unique reads are sequenced for increasing total read count.http://smithlabresearch.org/software/preseqDOI: 10.1038/nmeth.2375

A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

QualiMap

Quality control of alignment data and its derivatives like feature counts.http://qualimap.bioinfo.cipf.esDOI: 10.1093/bioinformatics/btv566; 10.1093/bioinformatics/bts503

Genomic origin of reads

Classification of mapped reads as originating in exonic, intronic or intergenic regions. These can be displayed as either the number or percentage of mapped reads.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. This allows mapped reads to be grouped by whether they originate in an exonic region (for QualiMap, this may include 5′ and 3′ UTR regions as well as protein-coding exons), an intron, or an intergenic region (see the Qualimap 2 documentation).

The inferred genomic origins of RNA-seq reads are presented here as a bar graph showing either the number or percentage of mapped reads in each read dataset that have been assigned to each type of genomic region. This graph can be used to assess the proportion of useful reads in an RNA-seq experiment. That proportion can be reduced by the presence of intron sequences, especially if depletion of ribosomal RNA was used during sample preparation (Sims et al. 2014). It can also be reduced by off-target transcripts, which are detected in greater numbers at the sequencing depths needed to detect poorly-expressed transcripts (Tarazona et al. 2011).

Created with MultiQC

Gene Coverage Profile

Mean distribution of coverage depth across the length of all mapped transcripts.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. QualiMap uses this information to calculate the depth of coverage along the length of each annotated transcript. For a set of reads mapped to a transcript, the depth of coverage at a given base position is the number of high-quality reads that map to the transcript at that position (Sims et al. 2014).

QualiMap calculates coverage depth at every base position of each annotated transcript. To enable meaningful comparison between transcripts, base positions are rescaled to relative positions expressed as percentage distance along each transcript (0%, 1%, …, 99%). For the set of transcripts with at least one mapped read, QualiMap plots the cumulative mapped-read depth (y-axis) at each relative transcript position (x-axis). This plot shows the gene coverage profile across all mapped transcripts for each read dataset. It provides a visual way to assess positional biases, such as an accumulation of mapped reads at the 3′ end of transcripts, which may indicate poor RNA quality in the original sample (Conesa et al. 2016).

The Normalised plot is calculated by MultiQC to enable comparison of samples with varying sequencing depth. The cumulative mapped-read depth at each position across the averaged transcript position are divided by the total for that sample across the entire averaged transcript.

Created with MultiQC

RSeQC

Evaluates high throughput RNA-seq data.http://rseqc.sourceforge.netDOI: 10.1093/bioinformatics/bts356

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹⁰/₁₀ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	+ve strand	-ve strand	Non-splice reads	Splice reads
FAH000ZA1	5.8M	0.0M	3.7M	1.3M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH000ZA2	5.7M	0.0M	3.8M	1.2M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH000ZA3	6.8M	0.0M	4.7M	1.5M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAH000ZA4	6.1M	0.0M	3.9M	1.5M	0.0M	0.7M	0.3M	0.4M	0.6M	0.1M
FAH000ZA5	7.8M	0.0M	5.2M	1.8M	0.0M	0.7M	0.3M	0.3M	0.6M	0.1M
FAH000ZA6	6.7M	0.0M	4.2M	1.6M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH000ZA7	6.9M	0.0M	4.7M	1.4M	0.0M	0.7M	0.3M	0.4M	0.6M	0.1M
FAH000ZA8	5.5M	0.0M	3.6M	1.1M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH000ZB1	7.0M	0.0M	4.8M	1.3M	0.0M	0.9M	0.4M	0.4M	0.8M	0.1M
FAH000ZB2	8.6M	0.0M	5.6M	2.0M	0.0M	0.9M	0.4M	0.5M	0.8M	0.1M
FAH000ZB3	8.5M	0.0M	5.8M	2.0M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH000ZB4	5.4M	0.0M	3.4M	1.2M	0.0M	0.7M	0.3M	0.4M	0.6M	0.1M
FAH000ZB5	7.7M	0.0M	4.9M	1.9M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH000ZB6	4.5M	0.0M	2.8M	0.9M	0.0M	0.7M	0.3M	0.3M	0.6M	0.1M
FAH000ZB7	6.8M	0.0M	4.6M	1.4M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH000ZB8	5.5M	0.0M	3.3M	1.3M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH007LA1	7.4M	0.0M	4.9M	1.7M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH007LA2	5.6M	0.0M	3.8M	1.0M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH007LA3	7.3M	0.0M	5.0M	1.5M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH007LA4	5.5M	0.0M	3.6M	1.1M	0.0M	0.7M	0.4M	0.4M	0.6M	0.1M
FAH007LB1	6.3M	0.0M	4.2M	1.2M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH007LB2	7.5M	0.0M	5.2M	1.4M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAH007LB3	5.7M	0.0M	3.8M	1.2M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAH007LB4	7.9M	0.0M	5.3M	1.7M	0.0M	0.9M	0.4M	0.4M	0.8M	0.1M
FAI000ZA1	7.6M	0.0M	5.1M	1.7M	0.0M	0.8M	0.4M	0.4M	0.8M	0.1M
FAI000ZA2	4.4M	0.0M	2.7M	1.0M	0.0M	0.7M	0.3M	0.3M	0.6M	0.1M
FAI000ZA3	10.9M	0.0M	7.4M	2.4M	0.0M	1.1M	0.5M	0.5M	1.0M	0.1M
FAI000ZA4	5.2M	0.0M	3.3M	1.3M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAI000ZA5	5.7M	0.0M	3.5M	1.4M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAI000ZA6	7.9M	0.0M	5.3M	1.7M	0.0M	0.9M	0.4M	0.5M	0.8M	0.1M
FAI000ZA7	5.9M	0.0M	4.0M	1.2M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAI000ZA8	11.1M	0.0M	7.5M	2.4M	0.0M	1.1M	0.5M	0.6M	1.0M	0.1M
FAI000ZB1	7.1M	0.0M	4.8M	1.6M	0.0M	0.7M	0.3M	0.4M	0.6M	0.1M
FAI000ZB2	6.9M	0.0M	4.1M	1.9M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAI000ZB3	5.5M	0.0M	3.5M	1.3M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAI000ZB4	7.8M	0.0M	5.2M	1.7M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAI000ZB5	6.0M	0.0M	3.9M	1.5M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAI000ZB6	7.4M	0.0M	5.1M	1.5M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAI000ZB7	6.4M	0.0M	4.0M	1.6M	0.0M	0.7M	0.4M	0.4M	0.7M	0.1M
FAI000ZB8	5.4M	0.0M	3.6M	1.2M	0.0M	0.5M	0.3M	0.3M	0.5M	0.0M
FAI078AA1	6.5M	0.0M	4.3M	1.4M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAI078AA2	9.5M	0.0M	6.6M	2.0M	0.0M	0.9M	0.4M	0.4M	0.8M	0.1M
FAI078AA3	3.1M	0.0M	1.9M	0.7M	0.0M	0.5M	0.2M	0.2M	0.4M	0.0M
FAI078AA4	3.6M	0.0M	2.2M	0.7M	0.0M	0.6M	0.3M	0.3M	0.5M	0.1M
FAI078AB1	5.7M	0.0M	4.0M	1.0M	0.0M	0.8M	0.4M	0.4M	0.7M	0.1M
FAI078AB2	4.9M	0.0M	3.2M	1.1M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M
FAI078AB3	9.1M	0.0M	6.2M	1.9M	0.0M	0.9M	0.4M	0.4M	0.8M	0.1M
FAI078AB4	4.2M	0.0M	2.6M	0.9M	0.0M	0.6M	0.3M	0.3M	0.6M	0.1M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: rseqc_bam_stat_table

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non_splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count

Samtools

Toolkit for interacting with BAM/CRAM files.http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Percent mapped

Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.

For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.

Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).

Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.

Created with MultiQC

Alignment stats

This module parses the output from samtools stats. All numbers in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹³/₁₃ columns.

Sample Name	Total sequences	Mapped & paired	Properly paired	Duplicated	QC Failed	Reads MQ0	Mapped bases (CIGAR)	Bases Trimmed	Duplicated bases	Diff chromosomes	Other orientation	Inward pairs	Outward pairs
FAH000ZA1	4.5M	0.0M	0.0M	3.7M	0.0M	0.1M	494.6Mb	0.0Mb	444.2Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA2	4.5M	0.0M	0.0M	3.8M	0.0M	0.1M	497.5Mb	0.0Mb	445.9Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA3	5.4M	0.0M	0.0M	4.7M	0.0M	0.1M	580.3Mb	0.0Mb	552.3Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA4	4.6M	0.0M	0.0M	3.9M	0.0M	0.1M	502.6Mb	0.0Mb	460.4Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA5	6.0M	0.0M	0.0M	5.2M	0.0M	0.2M	611.2Mb	0.0Mb	599.9Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA6	5.1M	0.0M	0.0M	4.2M	0.0M	0.1M	547.9Mb	0.0Mb	499.0Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA7	5.5M	0.0M	0.0M	4.7M	0.0M	0.1M	575.5Mb	0.0Mb	547.1Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZA8	4.4M	0.0M	0.0M	3.6M	0.0M	0.1M	484.1Mb	0.0Mb	424.5Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB1	5.7M	0.0M	0.0M	4.8M	0.0M	0.1M	607.7Mb	0.0Mb	555.2Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB2	6.6M	0.0M	0.0M	5.6M	0.0M	0.2M	687.5Mb	0.0Mb	641.7Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB3	6.6M	0.0M	0.0M	5.8M	0.0M	0.1M	709.6Mb	0.0Mb	682.2Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB4	4.2M	0.0M	0.0M	3.4M	0.0M	0.1M	444.6Mb	0.0Mb	397.8Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB5	5.8M	0.0M	0.0M	4.9M	0.0M	0.2M	597.7Mb	0.0Mb	564.8Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB6	3.5M	0.0M	0.0M	2.8M	0.0M	0.1M	377.6Mb	0.0Mb	327.4Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB7	5.4M	0.0M	0.0M	4.6M	0.0M	0.1M	586.4Mb	0.0Mb	546.1Mb	0.0M	0.0M	0.0M	0.0M
FAH000ZB8	4.2M	0.0M	0.0M	3.3M	0.0M	0.1M	441.3Mb	0.0Mb	385.5Mb	0.0M	0.0M	0.0M	0.0M
FAH007LA1	5.6M	0.0M	0.0M	4.9M	0.0M	0.2M	583.2Mb	0.0Mb	557.5Mb	0.0M	0.0M	0.0M	0.0M
FAH007LA2	4.6M	0.0M	0.0M	3.8M	0.0M	0.1M	506.9Mb	0.0Mb	453.9Mb	0.0M	0.0M	0.0M	0.0M
FAH007LA3	5.8M	0.0M	0.0M	5.0M	0.0M	0.1M	619.0Mb	0.0Mb	587.4Mb	0.0M	0.0M	0.0M	0.0M
FAH007LA4	4.4M	0.0M	0.0M	3.6M	0.0M	0.1M	474.3Mb	0.0Mb	429.2Mb	0.0M	0.0M	0.0M	0.0M
FAH007LB1	5.0M	0.0M	0.0M	4.2M	0.0M	0.1M	551.0Mb	0.0Mb	504.3Mb	0.0M	0.0M	0.0M	0.0M
FAH007LB2	6.1M	0.0M	0.0M	5.2M	0.0M	0.1M	652.5Mb	0.0Mb	610.4Mb	0.0M	0.0M	0.0M	0.0M
FAH007LB3	4.6M	0.0M	0.0M	3.8M	0.0M	0.1M	492.2Mb	0.0Mb	449.2Mb	0.0M	0.0M	0.0M	0.0M
FAH007LB4	6.2M	0.0M	0.0M	5.3M	0.0M	0.1M	662.9Mb	0.0Mb	621.6Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA1	6.0M	0.0M	0.0M	5.1M	0.0M	0.1M	643.0Mb	0.0Mb	602.1Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA2	3.4M	0.0M	0.0M	2.7M	0.0M	0.1M	363.2Mb	0.0Mb	316.0Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA3	8.5M	0.0M	0.0M	7.4M	0.0M	0.2M	923.4Mb	0.0Mb	879.1Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA4	4.0M	0.0M	0.0M	3.3M	0.0M	0.1M	410.1Mb	0.0Mb	377.0Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA5	4.2M	0.0M	0.0M	3.5M	0.0M	0.1M	431.5Mb	0.0Mb	401.3Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA6	6.2M	0.0M	0.0M	5.3M	0.0M	0.1M	663.0Mb	0.0Mb	620.5Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA7	4.6M	0.0M	0.0M	4.0M	0.0M	0.1M	502.2Mb	0.0Mb	472.1Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZA8	8.6M	0.0M	0.0M	7.5M	0.0M	0.2M	929.9Mb	0.0Mb	890.5Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB1	5.5M	0.0M	0.0M	4.8M	0.0M	0.1M	592.0Mb	0.0Mb	562.3Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB2	4.9M	0.0M	0.0M	4.1M	0.0M	0.2M	478.6Mb	0.0Mb	454.1Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB3	4.2M	0.0M	0.0M	3.5M	0.0M	0.1M	438.0Mb	0.0Mb	404.3Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB4	6.1M	0.0M	0.0M	5.2M	0.0M	0.1M	640.4Mb	0.0Mb	603.8Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB5	4.6M	0.0M	0.0M	3.9M	0.0M	0.1M	478.3Mb	0.0Mb	449.7Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB6	5.9M	0.0M	0.0M	5.1M	0.0M	0.1M	635.0Mb	0.0Mb	597.3Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB7	4.8M	0.0M	0.0M	4.0M	0.0M	0.1M	499.4Mb	0.0Mb	464.5Mb	0.0M	0.0M	0.0M	0.0M
FAI000ZB8	4.2M	0.0M	0.0M	3.6M	0.0M	0.1M	457.5Mb	0.0Mb	433.1Mb	0.0M	0.0M	0.0M	0.0M
FAI078AA1	5.1M	0.0M	0.0M	4.3M	0.0M	0.1M	557.6Mb	0.0Mb	516.3Mb	0.0M	0.0M	0.0M	0.0M
FAI078AA2	7.5M	0.0M	0.0M	6.6M	0.0M	0.1M	812.1Mb	0.0Mb	784.0Mb	0.0M	0.0M	0.0M	0.0M
FAI078AA3	2.4M	0.0M	0.0M	1.9M	0.0M	0.1M	259.7Mb	0.0Mb	227.9Mb	0.0M	0.0M	0.0M	0.0M
FAI078AA4	2.9M	0.0M	0.0M	2.2M	0.0M	0.1M	312.0Mb	0.0Mb	265.0Mb	0.0M	0.0M	0.0M	0.0M
FAI078AB1	4.8M	0.0M	0.0M	4.0M	0.0M	0.1M	518.5Mb	0.0Mb	471.3Mb	0.0M	0.0M	0.0M	0.0M
FAI078AB2	3.8M	0.0M	0.0M	3.2M	0.0M	0.1M	414.7Mb	0.0Mb	374.6Mb	0.0M	0.0M	0.0M	0.0M
FAI078AB3	7.2M	0.0M	0.0M	6.2M	0.0M	0.1M	780.4Mb	0.0Mb	747.3Mb	0.0M	0.0M	0.0M	0.0M
FAI078AB4	3.3M	0.0M	0.0M	2.6M	0.0M	0.1M	354.2Mb	0.0Mb	310.6Mb	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-stats-dp_table

Sort	Column	Description	ID	Scale
\|\|	Total sequences	Total sequences	`raw_total_sequences`	read_count
\|\|	Mapped & paired	Paired-end technology bit set + both mates mapped	`reads_mapped_and_paired`	read_count
\|\|	Properly paired	Proper-pair bit set	`reads_properly_paired`	read_count
\|\|	Duplicated	PCR or optical duplicate bit set	`reads_duplicated`	read_count
\|\|	QC Failed	QC Failed	`reads_QC_failed`	read_count
\|\|	Reads MQ0	Reads mapped and MQ=0	`reads_MQ0`	read_count
\|\|	Mapped bases (CIGAR)	Mapped bases (CIGAR)	`bases_mapped__cigar`	base_count
\|\|	Bases Trimmed	Bases Trimmed	`bases_trimmed`	base_count
\|\|	Duplicated bases	Duplicated bases	`bases_duplicated`	base_count
\|\|	Diff chromosomes	Pairs on different chromosomes	`pairs_on_different_chromosomes`	read_count
\|\|	Other orientation	Pairs with other orientation	`pairs_with_other_orientation`	read_count
\|\|	Inward pairs	Inward oriented pairs	`inward_oriented_pairs`	read_count
\|\|	Outward pairs	Outward oriented pairs	`outward_oriented_pairs`	read_count

Flagstat

This module parses the output from samtools flagstat

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
FAH000ZA1	5.8M	5.8M	5.8M	1.3M	3.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA2	5.7M	5.7M	5.7M	1.2M	3.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA3	6.8M	6.8M	6.8M	1.5M	4.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA4	6.1M	6.1M	6.1M	1.5M	3.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA5	7.8M	7.8M	7.8M	1.8M	5.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA6	6.7M	6.7M	6.7M	1.6M	4.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA7	6.9M	6.9M	6.9M	1.4M	4.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZA8	5.5M	5.5M	5.5M	1.1M	3.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB1	7.0M	7.0M	7.0M	1.3M	4.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB2	8.6M	8.6M	8.6M	2.0M	5.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB3	8.5M	8.5M	8.5M	2.0M	5.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB4	5.4M	5.4M	5.4M	1.2M	3.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB5	7.7M	7.7M	7.7M	1.9M	4.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB6	4.5M	4.5M	4.5M	0.9M	2.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB7	6.8M	6.8M	6.8M	1.4M	4.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH000ZB8	5.5M	5.5M	5.5M	1.3M	3.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LA1	7.4M	7.4M	7.4M	1.7M	4.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LA2	5.6M	5.6M	5.6M	1.0M	3.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LA3	7.3M	7.3M	7.3M	1.5M	5.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LA4	5.5M	5.5M	5.5M	1.1M	3.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LB1	6.3M	6.3M	6.3M	1.2M	4.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LB2	7.5M	7.5M	7.5M	1.4M	5.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LB3	5.7M	5.7M	5.7M	1.2M	3.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAH007LB4	7.9M	7.9M	7.9M	1.7M	5.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA1	7.6M	7.6M	7.6M	1.7M	5.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA2	4.4M	4.4M	4.4M	1.0M	2.7M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA3	10.9M	10.9M	10.9M	2.4M	7.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA4	5.2M	5.2M	5.2M	1.3M	3.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA5	5.7M	5.7M	5.7M	1.4M	3.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA6	7.9M	7.9M	7.9M	1.7M	5.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA7	5.9M	5.9M	5.9M	1.2M	4.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZA8	11.1M	11.1M	11.1M	2.4M	7.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB1	7.1M	7.1M	7.1M	1.6M	4.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB2	6.9M	6.9M	6.9M	1.9M	4.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB3	5.5M	5.5M	5.5M	1.3M	3.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB4	7.8M	7.8M	7.8M	1.7M	5.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB5	6.0M	6.0M	6.0M	1.5M	3.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB6	7.4M	7.4M	7.4M	1.5M	5.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB7	6.4M	6.4M	6.4M	1.6M	4.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI000ZB8	5.4M	5.4M	5.4M	1.2M	3.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AA1	6.5M	6.5M	6.5M	1.4M	4.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AA2	9.5M	9.5M	9.5M	2.0M	6.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AA3	3.1M	3.1M	3.1M	0.7M	1.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AA4	3.6M	3.6M	3.6M	0.7M	2.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AB1	5.7M	5.7M	5.7M	1.0M	4.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AB2	4.9M	4.9M	4.9M	1.1M	3.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AB3	9.1M	9.1M	9.1M	1.9M	6.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
FAI078AB4	4.2M	4.2M	4.2M	0.9M	2.6M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-table_table

Sort	Column	Description	ID	Scale
\|\|	Total Reads	Total Reads	`flagstat_total`	read_count
\|\|	Total Passed QC	Total Passed QC	`total_passed`	read_count
\|\|	Mapped	Mapped	`mapped_passed`	read_count
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed`	read_count
\|\|	Duplicates	Duplicates	`duplicates_passed`	read_count
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed`	read_count
\|\|	Properly Paired	Properly Paired	`properly_paired_passed`	read_count
\|\|	Self and mate mapped	Reads with itself and mate mapped	`with_itself_and_mate_mapped_passed`	read_count
\|\|	Singletons	Singletons	`singletons_passed`	read_count
\|\|	Mate mapped to diff chr	Mate mapped to different chromosome	`with_mate_mapped_to_a_different_chr_passed`	read_count
\|\|	Diff chr (mapQ >= 5)	Mate mapped to different chromosome (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed`	read_count

Flagstat: Percentage of total

This module parses the output from samtools flagstat

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
FAH000ZA1	100.0%	100.0%	100.0%	22.4%	64.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA2	100.0%	100.0%	100.0%	21.3%	65.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA3	100.0%	100.0%	100.0%	21.5%	68.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA4	100.0%	100.0%	100.0%	23.9%	64.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA5	100.0%	100.0%	100.0%	23.5%	67.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA6	100.0%	100.0%	100.0%	24.0%	63.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA7	100.0%	100.0%	100.0%	20.7%	68.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZA8	100.0%	100.0%	100.0%	19.1%	65.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB1	100.0%	100.0%	100.0%	18.8%	68.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB2	100.0%	100.0%	100.0%	23.3%	65.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB3	100.0%	100.0%	100.0%	23.0%	67.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB4	100.0%	100.0%	100.0%	22.9%	63.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB5	100.0%	100.0%	100.0%	24.6%	64.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB6	100.0%	100.0%	100.0%	21.0%	63.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB7	100.0%	100.0%	100.0%	19.9%	68.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH000ZB8	100.0%	100.0%	100.0%	24.1%	60.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LA1	100.0%	100.0%	100.0%	23.5%	65.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LA2	100.0%	100.0%	100.0%	17.6%	68.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LA3	100.0%	100.0%	100.0%	21.1%	68.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LA4	100.0%	100.0%	100.0%	20.2%	66.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LB1	100.0%	100.0%	100.0%	19.7%	67.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LB2	100.0%	100.0%	100.0%	19.0%	69.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LB3	100.0%	100.0%	100.0%	20.2%	66.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAH007LB4	100.0%	100.0%	100.0%	21.5%	66.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA1	100.0%	100.0%	100.0%	21.8%	66.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA2	100.0%	100.0%	100.0%	23.6%	60.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA3	100.0%	100.0%	100.0%	21.8%	67.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA4	100.0%	100.0%	100.0%	24.1%	62.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA5	100.0%	100.0%	100.0%	25.3%	62.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA6	100.0%	100.0%	100.0%	21.5%	66.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA7	100.0%	100.0%	100.0%	21.2%	67.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZA8	100.0%	100.0%	100.0%	22.0%	67.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB1	100.0%	100.0%	100.0%	22.3%	67.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB2	100.0%	100.0%	100.0%	28.1%	60.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB3	100.0%	100.0%	100.0%	23.8%	63.7%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB4	100.0%	100.0%	100.0%	22.2%	66.5%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB5	100.0%	100.0%	100.0%	24.4%	64.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB6	100.0%	100.0%	100.0%	20.2%	68.6%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB7	100.0%	100.0%	100.0%	25.3%	62.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI000ZB8	100.0%	100.0%	100.0%	22.5%	67.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AA1	100.0%	100.0%	100.0%	21.4%	66.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AA2	100.0%	100.0%	100.0%	20.8%	69.4%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AA3	100.0%	100.0%	100.0%	21.4%	62.9%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AA4	100.0%	100.0%	100.0%	20.4%	62.1%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AB1	100.0%	100.0%	100.0%	17.0%	69.2%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AB2	100.0%	100.0%	100.0%	22.4%	64.0%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AB3	100.0%	100.0%	100.0%	21.0%	68.8%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%
FAI078AB4	100.0%	100.0%	100.0%	21.2%	63.3%	0.0%	0.0%	0.0%	0.0%	0.0%	0.0%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-pct-table_table

Sort	Column	Description	ID
\|\|	Total Reads	Total Reads	`flagstat_total_pct`
\|\|	Total Passed QC	Total Passed QC	`total_passed_pct`
\|\|	Mapped	Mapped	`mapped_passed_pct`
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed_pct`
\|\|	Duplicates	Duplicates	`duplicates_passed_pct`
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed_pct`
\|\|	Properly Paired	Properly Paired	`properly_paired_passed_pct`
\|\|	Self and mate mapped	Self and mate mapped	`with_itself_and_mate_mapped_passed_pct`
\|\|	Singletons	Singletons	`singletons_passed_pct`
\|\|	Mate mapped to diff chr	Mate mapped to diff chr	`with_mate_mapped_to_a_different_chr_passed_pct`
\|\|	Diff chr (mapQ >= 5)	Diff chr (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed_pct`

Mapped reads per contig

The samtools idxstats tool counts the number of mapped reads per chromosome / contig. Chromosomes with < 0.1% of the total aligned reads are omitted from this plot.

Created with MultiQC

Sample relationships

Plots interrogating sample relationships, based on final count matrices.

STAR_SALMON DESeq2 sample similarity

is generated from clustering by Euclidean distances between DESeq2 rlog values for each sample in the deseq2_qc.r script.

Created with MultiQC

STAR_SALMON DESeq2 PCA plot

PCA plot between samples in the experiment. These values are calculated using DESeq2 in the deseq2_qc.r script.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
CUSTOM_GETCHROMSIZES	getchromsizes	`1.21`
CUSTOM_TX2GENE	python	`3.10.4`
DESEQ2_QC_STAR_SALMON	bioconductor-deseq2	`1.46.0`
	r-base	`4.4.2`
DupRadar	bioconductor-dupradar	`1.32.0`
GTF2BED	perl	`5.26.2`
GTF_FILTER	python	`3.9.5`
MAKE_TRANSCRIPTS_FASTA	rsem	`1.3.1`
	star	`2.7.10a`
PICARD_MARKDUPLICATES	picard	`3.1.1`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
QUALIMAP_RNASEQ	qualimap	`2.3`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SALMON_QUANT	salmon	`1.10.3`
SAMTOOLS_FLAGSTAT	samtools	`1.21`
SAMTOOLS_IDXSTATS	samtools	`1.21`
SAMTOOLS_INDEX	samtools	`1.21`
SAMTOOLS_SORT_QUALIMAP	samtools	`1.21`
SAMTOOLS_STATS	samtools	`1.21`
SE_GENE_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SE_TRANSCRIPT_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SORTMERNA_INDEX	sortmerna	`4.3.7`
TXIMETA_TXIMPORT	bioconductor-tximeta	`1.20.1`
Workflow	Nextflow	`25.04.7`
	nf-core/rnaseq	`v3.22.2-g3816d48`

nf-core/rnaseq Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.https://github.com/nf-core/rnaseq

Methods

Data was processed using nf-core/rnaseq v3.22.2 (doi: 10.5281/zenodo.1400710) of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.04.7 (Di Tommaso et al., 2017) with the following command:

nextflow run nf-core/rnaseq -r 3.22.2 -c ../rnaseq.config -params-file ../params_rnaseq.json -resume -profile crg_slurm

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnaseq Workflow Summary

this information is collected when the pipeline is started.https://github.com/nf-core/rnaseq

Input/output options

input: ../samplesheet_Drosophila.csv
multiqc_title: PTox-Production-phase2-Drosophila-include-dups
outdir: ./rnaseq_output

Reference genome options

fasta: ../../refs/Drosophila/genome.fa
gtf: ../../refs/Drosophila/genome_annotation.gtf
gtf_extra_attributes: gene
star_index: ../../rnaseq_run-Drosophila/rnaseq_output/genome/index/star

Read trimming options

extra_fastp_args: --length_required=20 --trim_poly_g --poly_g_min_len=20 --trim_poly_x --poly_x_min_len=15 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --dont_eval_duplication --cut_tail
trimmer: fastp

Read filtering options

remove_ribo_rna: true

UMI options

umi_discard_read: 0

Alignment options

extra_salmon_quant_args: --noLengthCorrection
extra_star_align_args: --alignIntronMax 1000000 --alignIntronMin 20 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --outFilterMismatchNmax 999 --outFilterMultimapNmax 20 --outFilterType BySJout --outFilterMismatchNoverLmax 0.1 --clip3pAdapterSeq AAAAAAAA
stranded_threshold: 0.7

Process skipping options

skip_alignment: true
skip_bigwig: true
skip_biotype_qc: true
skip_preseq: false
skip_pseudo_alignment: true
skip_stringtie: true

Generic options

monochrome_logs: true
trace_report_suffix: 2026-04-01_11-09-07

Core Nextflow options

configFiles: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq/nextflow.config, /users/project/precisiontox_008279_no_backup/production_phase2_data_dec2025/analyse_duplicated_data/rnaseq_run-Drosophila/../rnaseq.config
containerEngine: apptainer
launchDir: /users/project/precisiontox_008279_no_backup/production_phase2_data_dec2025/analyse_duplicated_data/rnaseq_run-Drosophila
profile: crg_slurm
projectDir: /users/rg/vntasis/.nextflow/assets/nf-core/rnaseq
revision: 3.22.2
runName: tiny_boyd
userName: vntasis
workDir: /users/project/precisiontox_008279_no_backup/production_phase2_data_dec2025/analyse_duplicated_data/rnaseq_run-Drosophila/work

PTox-Production-phase2-Drosophila-include-dups

MultiQC Toolbox

Apply Highlight Samples

Rename Samples Bulk input Apply

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots All None

Save Settings

Load Settings

Tool Citations

About MultiQC

PTox-Production-phase2-Drosophila-include-dups

Report AI Summary

General Statistics

AI Summary

General Statistics: Columns

Sample status checks

Strandedness Checks

AI Summary

Samples strandedness check: Columns

DupRadar

AI Summary

Picard

Mark Duplicates Help

AI Summary

Preseq

Complexity curve (molecule count)

AI Summary

QualiMap

Genomic origin of reads Help

AI Summary

Gene Coverage Profile Help

AI Summary

RSeQC

Read Distribution

AI Summary

Read Duplication

AI Summary

Junction Annotation

AI Summary

Junction Saturation

AI Summary

Infer experiment

AI Summary

Bam Stat

AI Summary

RSeQC: Bam Stat: Columns

Samtools

Percent mapped Help

AI Summary

Alignment stats

AI Summary

Samtools: stats: Alignment Stats: Columns

Flagstat

AI Summary

Samtools: flagstat: read count: Columns

Flagstat: Percentage of total

AI Summary

Samtools: flagstat: percentage of total: Columns

Mapped reads per contig

AI Summary

Sample relationships

STAR_SALMON DESeq2 sample similarity

AI Summary

STAR_SALMON DESeq2 PCA plot

AI Summary

Software Versions

AI Summary

nf-core/rnaseq Methods Description

AI Summary

Methods

References

Notes:

nf-core/rnaseq Workflow Summary

AI Summary

Highlight Samples

Rename Samples

Show / Hide Samples

Choose Plots

Mark Duplicates

Genomic origin of reads

Gene Coverage Profile

Percent mapped